GenePrediction:GLEAN_1795 Details

Name: GLEAN_1795
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1218419..1220359 (+ strand)
Length: 1941
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1218419..1218423 (+ strand)
Length: 5
Type: CDS
Source: GLEAN
Position: GCSC_144:1218569..1218593 (+ strand)
Length: 25
Type: CDS
Source: GLEAN
Position: GCSC_144:1218726..1218830 (+ strand)
Length: 105
Type: CDS
Source: GLEAN
Position: GCSC_144:1219112..1220359 (+ strand)
Length: 1248
>GLEAN_1795 class=GenePrediction position=GCSC_144:1218419..1220359 (+ strand)
ATGGGGTATGTTCTATTCTTCACCCGTTGCCCCTCTCGTTCATCAGCAGCATCTTCATCGTCCCTTTGGTCCTCGCCTTC
AGGAATCGAGGCTGCCTGATCCGAGCCCAATCCGCCAGCTATTGCTCATGCTAACCACATATGTCTACAGTAAGGAGGAG
AAGCCGCATATCAACGTAAGTTTACGATCATATCGATCCGCCGTCCATTAACGCTCTGCTCGTCGCTGCCTTTCGTCCAA
CTCGAAAGCATCGAGCTTGGGCTTGCAATATCATACCTGCGACTCTTTCCTAACTCTCTTTCTACAGGTCGTGGTCATCG
GCCACGTCGACTCCGGCAAGTCTACGACTACCGGTCATCTGATCTACCAGTGCGGTGGTATCGACAAGCGTACCATCGAG
AAGTTCGAGAAGGTTCGTTTTTTCCCTCTTGCTCGCATCTACCCTACCTTACCCTACTGCACACGACACGTCCACTTCCT
TTTTCTCATTATCAGAATGTGGGGTTGGAGGGGCAAATCCTCTTCCCTGTCTTTCTGCCTTGTGGACCCTGAAAATTTTT
TGGGCGGTCAGGTTCCAAGCACAATCATCTTGGTGCACGGACCACAACCAGATCCAACCCAACCCCATACTCTATTTACG
CCATCTCATCCCCACCTGCTTGCATTTAGATTTGCCGCTAACACCCAAACCAGGAAGCCGCTGAGCTGGGCAAGGGCTCC
TTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGCGGTATCACCATCGATATCGCTCTTTGGAAGTT
CGAGACCCCCAAGTACTACGTCACCGTCATTGACGCTCCCGGTCACCGTGACTTCATCAAGAACATGATCACGGGCACGT
CGCAGGCCGACTGCGCTATCCTGATCATTGCTGCTGGTACGGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACC
CGCGAGCACGCCCTGCTGGCCTACACCCTTGGTGTCCGGCAGCTCATTGTCGCCATCAACAAGATGGACACCACCAAGTG
GTCTGAGGCCCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGACCGTTG
CCTTTGTGCCCATCTCCGGCTTCAACGGCGACAACATGCTGGCTGCCTCCACCAACTGCCCCTGGTACAAGGGCTGGGAG
AAGGAGGGCAAGAGCGGCAAGGTCACCGGCAAGACTCTGCTTGAGGCCATCGATGCTGTCGAGATGCCCAAGCGCCCCAC
CGACAAGCCCCTGCGTCTGCCCCTCCAGGACGTCTACAAGATTGGCGGTATCGGCACAGTCCCGGTCGGCCGTATCGAGA
CGGGCATCATCAAGCCCGGTATGGTCGTCACCTTCGCTCCCTCCAACGTCACCACGGAAGTCAAGTCCGTCGAGATGCAC
CACGAGCAGCTTACCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCG
TGGTAACGTCGCCGGTGACAGCAAGAACGACCCGCCCATGGGCGCTGCCTCGTTCAACGCTCAGGTCATTGTCCTGAACC
ACCCCGGTCAGGTCGGTGCCGGTTACGCCCCGGTTCTGGACTGCCACACTGCCCACATTGCGTGCAAGTTCGCCGAGATC
CTTGAGAAGATCGACCGCCGTACCGGCAAGTCGGTTGAGAACAACCCCAAGTTCATCAAGTCTGGTGACGCCGCCATCGT
CAAGCTGGTGCCCTCCAAGCCCATGTGCGTTGAGGCCTTCACCGACTACCCGCCCCTGGGCCGCTTCGCCGTCCGTGACA
TGCGCCAGACCGTTGCCGTCGGTGTCATCAAGTCCGTCGAGAAGGCCGCTGCTGGTGCCGCCAAGGTCACCAAGTCGGCT
GCCAAGGCTGCCAAGAAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62