GenePrediction:GLEAN_1796 Details

Name: GLEAN_1796
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1225969..1227705 (+ strand)
Length: 1737
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1225969..1226346 (+ strand)
Length: 378
Type: CDS
Source: GLEAN
Position: GCSC_144:1226401..1226498 (+ strand)
Length: 98
Type: CDS
Source: GLEAN
Position: GCSC_144:1226574..1227705 (+ strand)
Length: 1132
>GLEAN_1796 class=GenePrediction position=GCSC_144:1225969..1227705 (+ strand)
ATGCTAAAACAAGAGCCGCCAGCTATGGAAACAAGCATACCAACTCCTCCGTACGACGACCACAGTTCGCGGCCGCAGCC
TGTCTCGCGCAAAAGCCCGTCGTCCACGTCCTCCTCGCTGGCCTCTGCTGTCCGTTCTGCCAAGAGCGGCAATGGCAACA
GCAGCAATACCGGCACCCCAACCAGCTCGATCAATGGCCACACCCCCCACCACAACAGCCACCGGGCATCAAAGCGATCG
GCCACCGCCCCGTCGACATCCCACTCTCACTCCCACCACTCCACCTCCAGCCATCATGGCTCGCCCCATCACGACAGCGA
CGGTCGCCACAAGCGCGTATGGAAGGCCTGCGAGCGTTGTCGTATGAAGAAGACAAAGGTCCGTCACGAGGTTCTGCTGC
TGCTGTTTTGTCCAGCGTGCTGACTGGTGCAGTGTGACGGAGAGTTTCCCTGCAAGAGGTGTAAGGATGACGGCCTGGTC
TGTACCGCTGGCACGCGCAAGAAGACAGAATACAAGCAATTGCCGAAAGGGTAAGCATCTTGGCCTCCATCGCCCCTCTT
CCCTCTCGGGGACGCGAGCTGACGACGGCCTCCCACTGGAATCAGATATGCCGAAGTTCTGGAGAACACACAGTTCGCAT
TAGTAGCCACCGTGCACAAGCTCTACAGCATGGTTCGCGCTGCCCAGACCTGGGATCTCGGCGAGCCCGAGCTCAACGAG
CGTGGCCAGCCGGTGATTCACAGCATCGCTGCCAAGCTCGGTTGCATCCGCCCCAACAACGATCCGGACCTGCCAATGGG
CACCTCGGTTTTCCCCGAGGACGAGTCTGACCTGGCCGAGCTCGCCGCCCAGCTCGAGGAGCAACACAAGCAGCGGGAGA
CCGAGCAGGCCGTCCAGGCTGCCGCCGCCCAGGCTCAAGCTCAGGTCGAGGCACAACAAGCCCAGGCCCAGATCCGCTCG
CAGACATCCGCCGTCCCCATTGCAGTGCCTGGCTCTGCCCCTGCCGCCATGGTGGCCGGTGGCGGTGGATTCGATATGGC
CGGCCTTGGCCGTTTCGACCGTGCGAGCTCTTCCGAAGAGCTGGACACCTTCTCGGACATGGACGACTACCGCAAGAATG
TCTTCGGCAATGGCAACGACAGCAGCGTCAACAGCGCCAGCACGACCATGTCGCCCCAGAGTCTCTCCTTCAACGACTTC
GATGCCGTGTCCACCCAGTCTGATGGGTTCGTCGCACCCTCTCCGACATTACAAACGGCCCAATTCAACAACTGGATCGG
CGGCCGGACTTCGCTGGACTTGAGTGCTCAGACTCTCCAGCAGCAGCAACAGCAACAGCAACAGCAGCAGCAGCAACAGC
AACCGCAGGCCCAGATGCAGGAACAGCAGGCCCAGGCCCAGGCCCAGGCCCAGGCGCAGCAACAGCAGGCACAGCAGCAA
ATGCAGAAACTGCAACAGCAGCGCCAACGACAGAAGCGCTCGCTTCAGCAGCGACAACAAAGCGCGACCACACAGTCACC
ACTATCGCTGTCTGTTCCATCGGCCTTGGCGACAGCCATGCCCTACATGGCCTCACCGACATCCTACTTTGGCGTCGACA
TGTTGCGCCAGGGACTGGTCGAGTCCAACTTTGGCACCATCAAGCCTCATGTGCTGTCCTGCCCAAATCCCGAGGCGATG
TTGGGGATGGGCGACCCGATGATCTTCTCCGGCGGCTACGACGATGTGCTGATGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62