GenePrediction:GLEAN_1797 Details

Name: GLEAN_1797
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1234825..1237242 (+ strand)
Length: 2418
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1234825..1235180 (+ strand)
Length: 356
Type: CDS
Source: GLEAN
Position: GCSC_144:1235235..1237242 (+ strand)
Length: 2008
>GLEAN_1797 class=GenePrediction position=GCSC_144:1234825..1237242 (+ strand)
ATGGCGGACAGTGCCGGCACAGCCGACACCCCTGCACTGTTTGGACTGCGTGATGCGGTGTTCCGTCCATGGCCGCTGCC
AGGCCAGGAGCCAGCCAACATTGGCGACTTTGTGCGGCGGATCAAGGCCCAAGGCGGCGAGTTCCGCAAGCTGACAGAAG
AGAGCCTGCGCAAGGAGATCGAAGAGCGACGAACCAGGCGAGAGGCGGGAAACGGGAGCGATGGCGACGATGCGGACGAA
GCGTCTGGACGGGGTGCCGACGAGAATGAAGAGGCAGCGAATGACACGTTGGCTCACCGCACCAAAGGCATTGAAGCCAT
GATTGCGAAGCGTGACGAAGTGTTGCGAACGTTGGAGTGAGTGCAAACGGCTCCGAGTCCGTGCTCGTATGTGTGCTGAC
ATGGGTTCAGATCTGCTCTTCAGAACGGTCTCATCGTCGTCGACTTTGTCTCGCTACTGCTCTCGAAAGACCGGCCGACC
CAGGCGCTGCAGTCGCTCTCGCCGATGCTGCGCGAAAAGATTGGCATCGGCACGCTCAGTGCCGGCCGCATTGCCAACGC
GGCCCAAGCAGCCAAAGCACTGCAGACGCGACACGGTGGCGGCCGGGGCGGTGGAGGCGGGCCTGGTCTCGCGGGTGGGC
AGATCCTGGACGAGACGACACGGTCCAACGCACAGCGGGTGCTGGACCATAAGATTGAATGCGTCGGATGGCAGCTTCTG
GCCATGGATCGGGCGGCCGAGCTGCTGGCCGCTGGCCGCAAGCGCCTGCACGCCGAGCTGCGCCGTGAGCAGATGTACTG
GTCCGAAGTCGTTGCCGTTCGCGATCGCGGCTGGGCTCTCTCCCGCACTCCCGGCCAACGACGGCTCCTTCGCGTCAAGT
TTGGCTTCTCCGAGGCTGCCGCCGATCTGCGCGCTGCCGGCTTTGCACCACTGCGCCGCGTCAAGCGTGGTCACGTTGCC
CTCGACATCACCGCGCTGGGCCCGCCTTCGGCCATTGTCGTCACGCTTCGTCGCCGCAACGCAGCCGGCAATGTCGACAT
CATCGGCCGCTCGTCACCTCCAATTCGCCTGCCGCCGTCGGCTCCCCTCGAGAACCGAATCCTCGAGGCTCGCAACACCG
TCTACGCCAAGGAGCTCTGGCGTGAGCTCAACCGCGAGGCTCGTCTCCTCGTGGCCCACGGCATCGCACTTCGAGGCCCC
CTCATCGTCTTTCCTGCCGGCGCTCACACCGAGGGCATCATCGCCCTCGAACCCCTCCAGCTAGTTGCTTCTGATGCGGG
CGCGGTTGCCATCGCCACCGCCGAGATGGACAGAGTCGCCGAGGTTACCGCGTCGTCGCTGCACCTCTTTCTCGCCCACG
GCCACCGCCACCACTACCGTCTGCGCTCGGTGCCTGCGCCGCCGTCCGACAGCACCGGCACCCCGCCGCCAGCCTACTAC
CTGCTGCGGCCGATCCTGGCCAACCTCAAGTACGAAAAGGCCCTCGAGCACATTGCGCGCTTTCTCTCGGACCTTTGCTC
GATCCTGCATCGCGTTGGCCACACTACTGCCCAATTTACCCTGTTCGAGCGTCCTCTGGCCTCGTCTATCCCCCCCCCGA
CAGCCGGATCTGCCTCGCGCCAGCTGGCCGCGTCCGAAGGTGTCTGCATGGCCTTTCTGAACCCGCGCGAGTTCACGTTC
GAGCTCACCCTTGCGCCCGACATCCGCCTCTCCATCCGCAGCCGTACTACCAACATGCCACTTCGCACACAGTACCTCAT
CCAGCTGCATCCTCCACCGACCGGTGGTAGCAGCCCCCTCCAGGACAGCTTCCCGCCCGCGGACAACTACGCGACGCTGC
GCGACGTGCTTGATTATGTCAGCAGCGCCGTGGGTCACGTGCTCGCGGCCGATGCCCGCAAGGCAGCCATCGCCCACGAG
GACGCATCCCAGACGGGCGTGATCTGGTCGAGGACGGTGGATGGGACGGCCTTGCAGCATCAGAACGATCCGCTCTGGGA
GATGCGGTTCAGCCTGACGTCAACGGACACGATCACGGAGCTAGACGAGATCCTAGATGCGGATGTGGACGAAGGGGACG
GTCGAGAAGCAGATGGAGACGGACACGTGTTAGGGAACCCGAACCTGAACACAAAATCCGAAACCGCAGATGAAGACGGC
CCCAGAGAGGATGGGGGTGACGACACGGCCCTCGTCGACGACGACAGCCCCCTCCGCAAGTTCTGCCCGCCAGAGCTGCG
GCTGTACGCGTCGTGGCCTCATGGGACGCTCGAGTCGGCCGTTTATCGCCGTTGGGCTTGGACGGCTGAGAGCCCTCAGC
AGCAGAAGCAGGAGGACGCCTCGCCGTCGACACTGCACGACATCGTCCAGGGCTGCATCAACGGCGAGCTGAAGCCGGCC
GCGGACACGGACCAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62