GenePrediction:GLEAN_1798 Details

Name: GLEAN_1798
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1246370..1247684 (+ strand)
Length: 1315
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1246370..1246691 (+ strand)
Length: 322
Type: CDS
Source: GLEAN
Position: GCSC_144:1246742..1246879 (+ strand)
Length: 138
Type: CDS
Source: GLEAN
Position: GCSC_144:1246954..1247684 (+ strand)
Length: 731
>GLEAN_1798 class=GenePrediction position=GCSC_144:1246370..1247684 (+ strand)
ATGTCGACACAGTCAAGGAGACCGCGGCGACGTCCTGCGGCCGAAGAGCCCGAGGAAGAAGCACCCCGGAGACCGCGGCT
CAACCATGGCGCAAGCCAGCGGAGACCAGCGGATGAGGAAGACGAGGACGAAGACATGGAAGGAGGGACAGCAGCCGGAA
ACGCTGATGAAGACGACGAAGACGAAGAGGATGACGCGCCTCAGACGCAAGCCGACCGACAAGAACTCTACACAAATATC
CTTGCCAAGAAGCTGATCCGCTATGCGCTGAGTTGTGAGCCTCGTCGGCTGCCTATACGAAGACAGGCTATCAAGGAACA
GGGTACGTGCTGCTTGCCTCGATGCACTGGATGCTTTTCTGACACGCAACAGTCCTGGAGAACCAGGGAAAGAACTTTAG
AAAGGCGTTTCCCATTGCGCAAGAGCAGCTGCGAGCTATATTCGGCATGGAAATGGTCGAATGGCCGTCGCGTGACGAGT
CGACGATGAGCTTGCGAGAGCGGAGAAAGGGTGAGTGCCATCCCGAAACGACGGACAGGACAGGTGCTTTGGCTAACCCG
CATCGTGCCCTTTCACTGTGGCAGCCCTCAAGACACAGAAGCCCACCACTGCTACGGGCGCTGCTACCCGTGCCGACCGC
TATGTGCTCGTGTCGACTCTTCCGGATGCCTATCGCGCCAGCGTCTTCACCGCCCTCCCGACAGCTGCCTTGCCGCCAGC
CCCAGACTCAGCCTATATCGGGTTTGTCACCATGGTCGTCTCCCTGGTCACCTTGAGCGGCGGTGCTCTCGCCCAGACCG
AGCTGGAAAAGTACCTCACGATGCTGTACGGCGCACGGCATGGACCCGTGCGGGCTGATGCAGAGCTGCTGTCCGTGGCC
TCTGCGTTGGGAGACTACATTGACGATGACGACGGGGGCACCGGCGCCAGCCACGGCATCGACGCCTCCCAGCACCACGA
CACTGACGGCACGGCCACACAAGGCGGCACGCTGCAGTATCTCGTGCGCCATGGCTATCTTGTGCGCGTTGTGGAAGCAT
CGGCGGTCGATGGACGGGGGTCGGGCGGTGGCCGGTCCGGAGGGCCTGGCATGTCGGACGGCGCCAAGGTCACCTGGCAT
GTTGGACCGCGTGGTCGACTCGAGATCGGCCCGGCCGAAGTGGCGGCTGTTGTGCGGCACATGTACGGACCGGCTGCGGG
CGACGACTTGGAACGCAGACTGAAGACAAGCTTGCACGTCACGAATAAGGATCCGGCTGCACCAACGGACGGTGGCAACG
ATGGGAGGGAGGCCGGAGCGATGCAAGAAGGTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62