GenePrediction:GLEAN_1799 Details

Name: GLEAN_1799
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1256981..1260256 (+ strand)
Length: 3276
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1256981..1257465 (+ strand)
Length: 485
Type: CDS
Source: GLEAN
Position: GCSC_144:1257532..1257922 (+ strand)
Length: 391
Type: CDS
Source: GLEAN
Position: GCSC_144:1257986..1260256 (+ strand)
Length: 2271
>GLEAN_1799 class=GenePrediction position=GCSC_144:1256981..1260256 (+ strand)
ATGGCCGCCAGCATGGCGTCGCCAATAGCGACTATGAGCCCTTCCATGGGCCTGCATACCATCACAGAACACGACTACCG
ATTTCCTCGCAGGCCAATGGAGCATGCGCCGATGCACCATGATGAACACAACTCCCACTTCACCGATGACTCTTTCCAGC
AGGAGCTCATGAACCTGACCACCGTTGGCGCGTCTGCTGCTCCCGATCACGATCTCTCTACAAAGCCTTCAGATTCCTCC
AGTGGCTGCTTGAGGCTGGACATCGAATACAATAGCAGCTCAGTGCAGAAGCGCCCCTCGCGTGACGATGTGTTTGCGGA
CCTGCGCCTTGGTACCACGGCCAATGGCCCAGAACAGGACTCGCTAGCCACTGAGGTCTGGCGTTTTTTCTCCAAAACTA
AGCAGCAGCTGCCGAACCAGGAACGCATGGCGAATTTGAGCTGGCGCATGATGCACGTGAAGCTACGGAGTGCACACTCT
GACAAGTACGTTATCTCCCGGTATTCTCGTTCTTCTCCAACGGTAGCTTTTTTAGACTAACAACCGACCAGGTCCACGCA
ACATATACACGCTGCTGCCAATGCCCCCAGCGGCATCGCTCAGTTGAGAAAAACGTCTGAGCAGACCCAGGCCAGACAGG
ACCAGCACCACGGATTGTCCAGTTTGGATCCCATGACCTTGGATGAGTTTATTGACTCAAGGAACGTCGCCACTCCGGAG
GCCGGAACTTCGCTGCTGCTTGACGACGGATCGGCCAACGATGGTAGCAAGGACCCGACATCTGCCTACACTATGGCCTC
GGCAATCCCCATCAAGAACCGCCGCGAATCTTTCAAGCACTTTGTCCCGCAGAGTGTTCCTGTCCCCCCACACCAGACTG
CCCATAACGAATTTGGCTATGTCACGCGACACCACCGGAAAACGAGCATCGATGAACGCCGGGTTCGTTTTCCCCAAACC
ATCTCAACGTCCCACCCAAGCCCGCACCCAAAACTAACTGTTCAGACCCGGAAACGGCCGGCCAACTTCTCTCCTCATAT
CCCGGCTGTTGGGAACAATGCCGACTTGGATCTGGACGTGGACCTGCATGAATATGCCTTGGATCCTTCCCTGTCGAATG
GCTTGAACCATCACGACTCCAATGGTCACAATGGAATCTCGTTCGCGTTGGACTCCTTTATGGACAACGACAACATGATC
ACATCTGCTGGTCCTTTCCAGCAGCAGTTTTGCATTTCTCCCTCCACTTCGCCTATGGTGAACCACGGCCTGTTTACCAG
CATGTACAGCAACAGCGGGCCGTCCATGCCATCTTCTTCTATACCTACCACTGCCGACTACTATTCCCCCCCAGGTTCTG
CCTACCAGTCCACGGCTTCAACGCCTCACCCGTTGAACGATGGAAGCAACAGTGCGAGCACCGAGAACTTTTACTTGGGC
TCTATGGACATGCGCCATGGTCAGCAGCGTTCACAGCCGTTCCGCTCCGGTCAGCCTTCGGCGCCTTCAAGCATGGCCAC
TTCGGTCGGCGGCAGTGTTGCTACTGCTGGTGCCCACACGTCGTCTATTATGTACGGATCTGGCGCCGGCAACTCTCTCT
TCCACGGCCCTACTTCCACCACCGGCCCAGACTCAGCTTCGGTATTTTCGACGTCTTTGAGTCACGTCGACCCCACCCAG
GTGTTTCACCAGCAGCAACCGGACAACCAAATGTCTGCTCGGTCACCTGGTGTGAACGGAAACAGCCTGCTGGGCGACGC
TGTTTTTTCATTCGGCACTGATTCAGATATCGATGAGGAGGACAACGGGGCATTTGCTGACCGGACCCTCGGCCTCAGCG
GCGACTTTTCTCCAGGCATGGACGAGTCTTCGGGCTTGGACAGCAATGGCAACTCTCTCGGTGGCAGCACGCCGACGGGC
AGCAGCATGGGCTGGGACGCCACTCTGCCTGGCCAATTTAGCACGCAGGCGGCGCGGTACCCTGGTGGCATGCCTACTCG
CAAGCATGTTACCATTGGCCCGACGACTACGAACGAATTTGGCGATGTAAACGGCATTGACTGGGATAGCATGAACACAT
CGTCGTCCAACAAGTCTCTCTCGCGCACCCAATCGCAGTCATTCCGTCATGGAAGCATCAGCGGTGATCGTCGCCACCCC
AAGTTATCACGAAATGCGTCTACGCCCAACGTCAACAACATGGGAGGCAACTTTGACCGCTCCGGCCAAACCATGCCAGA
TTCGCCGCCGAATGATACCAACGGGATGGGCGGCAATGTGAACGCATCTGGCTTCAGCTCGGTGGCTCACAGCCGACCAT
CCTCCCCGCCCATGTCCGACTCAAAGCAAGGGTCTTCGACCAACCTTCAGGCTCAAGGGCAGGGCGATTCGGCGCCGACG
ACATGCACCAACTGCTTCACGCAGACCACTCCGCTCTGGCGGCGCAACCCCGAAGGTCAGCCGCTGTGCAACGCCTGTGG
CCTCTTCTTGAAGCTGCATGGCGTCGTCCGTCCGCTCAGCTTGAAGACAGATGTCATCAAGAAGCGAAACCGGGGCTCGG
GTGCACAGCTTCCTGTTGGTGGTACCAGCACGCGATCGAGCAAGAAGGGAGCGGTGTCGGGGACTAGCACGCGCAAGAAC
TCAACACTGTCTATCTCATCCATCGCTGCGGCCAATGCCAGCCAAGCGGTGGCAACACCGACAGTGACGACGCCGCCAGC
CCAACAGCGCTCTGGAAGCGTCAACGACGGGGACAGCCCGACGAGCGGTATTAACACTGCCGGCAGCACGCCGGCCAGCT
ACTCGGGCTCAGCGTCTGGCAGTGCTACGGGTGGAAAGGGAGTCATTCCCATTGCCGCGGCACCGCTGAAGAGCGTCCCG
GGTCCTGGTGCGGCGGCGATGACGCGTTCAATCACGGTGTCGACGTCGAAGCGGCAACGCCGTCACAGCAAGAGCGCCGG
GTCGTCGATGCAGCAGAACTCGATGTCGGGCAATGACGTCGGCCTCGGAGGCAGCAGCATAATGGACATTGACAGTCCCG
AGAACTCGACGGGCTCGAACGAAGCTGCAATCTCAATGAGTGCCAGTACGGGCTTGGGCTTCCTGGACAAGCATACCAAC
AACCTCGGCCTTGCGAACGCATTTGGTGTTACTCAGCGGCCGATGGTCGGCCCTGGCATGATCGGCATGGGCCCGGCAGC
ATCAGGATCGATGATGACACCTGGCGGCACTGCAGGCGGACCCCAGGAGTGGGAGTGGCTCACGATGAGTCTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62