GenePrediction:GLEAN_1800 Details

Name: GLEAN_1800
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1263282..1263674 (+ strand)
Length: 393
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1263282..1263284 (+ strand)
Length: 3
Type: CDS
Source: GLEAN
Position: GCSC_144:1263331..1263567 (+ strand)
Length: 237
Type: CDS
Source: GLEAN
Position: GCSC_144:1263636..1263674 (+ strand)
Length: 39
>GLEAN_1800 class=GenePrediction position=GCSC_144:1263282..1263674 (+ strand)
ATGGTAGGTATCATGCGCCATCCCGATTCCCCTGCTGCCGTTGTCACAGAACCCGGATGTTGACGATGGACGTGTGCAGG
CGGACAAGCTTCGAGCGCAGCAGGAACTCGAGCGGCTTCAGCAAAAGTACATCGGAACGGGCCATCCAGACACGACCAGT
TGGGAGTGGAAGTCGAACATTATGCGCGACACGTACTCTAGCATGGTGGGCCACCAGCCCATGCTGTCGTTTCTGTCGCT
GGCACAGAACGAACCGGCAACGAAGACGCGCCTGAAACTGCTCAAGGTGAGTGTGGCTGCTGTTTGGATTGCAGTCGCGT
GAAAGGCTGACAGGGGTTGCAGAACATGGTACAGCCCTGTGGTCCGCCACCGGCGCGCGACGACGAAGAATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62