GenePrediction:GLEAN_1803 Details

Name: GLEAN_1803
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1279040..1281491 (+ strand)
Length: 2452
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1279040..1279255 (+ strand)
Length: 216
Type: CDS
Source: GLEAN
Position: GCSC_144:1279332..1279715 (+ strand)
Length: 384
Type: CDS
Source: GLEAN
Position: GCSC_144:1279773..1280391 (+ strand)
Length: 619
Type: CDS
Source: GLEAN
Position: GCSC_144:1280457..1280690 (+ strand)
Length: 234
Type: CDS
Source: GLEAN
Position: GCSC_144:1280758..1281491 (+ strand)
Length: 734
>GLEAN_1803 class=GenePrediction position=GCSC_144:1279040..1281491 (+ strand)
ATGTCTCTCCGGTGGTGTGGAGAGGAAGTTGAGAACTCCTTCGGCCCAACAGTTCGCGACTGTCGAGACGGCTTCGACTT
CACCGTCTTCTTTGAGCAGTTGTTTCTGGCCATTGTGCCTTCGGCCGTGCTCGTGCTCCTGGTACCGTTCAGGATCTATA
AACTGTATCGAGCATCTCCAAAGGCGCGCGGCGGCTGGCTCCTTCCGCTGAAGATTGTGAGATCTGGCCTTGAGAGGAGA
CAAACATAAATGTGAGCACACAAACATAGGTATCCATGCTGACGTCAAACAGCTGGCTGCGACGACCTATACGACCCTGC
AGCTGTATCTCCTCGTACGATGGGTCGCGTCGCCTCCCTTCCCTGCCCGTGCTGCCACGTCCGCCGCCGCGCTCTCCGTG
CTGGCTGGCTGTGCTGTCTTGGCTCTATCGCCGTTGGAGCACCTACGGGCCCTCCGGCCGTCAACGCTCTTGCAGAGCTA
CCTGCTCCTCTCTGTCCTTTTTGACGCAGCTCTATGCCGGACGCTATGGATGATTGGGCGGGACTCCGCGATCGAGCGTG
TCTCTACGGCCATCACAGCGCTCAAGCTGGTCCTGCTGTGCCTCGAGATGGTGGAGAAGCGCCGTTGGCTCAAGCCGCAG
TATCGCGACGAGAAAGCCGAGGCCCTTTGCGGCATTGTGAACCGCAGCATGTACTAGTGGCTCAACAGCCTGTTTCTCAC
AGGCTACCACAAGATCCTGGTCCTGGCCGATATTGACGACATGGAGGAATCACACCGCGCCGAGGCGCTGGAGCGCAATC
TACAGGAGAGCTGGGCCAAGCTGCAAGAAACGGAGCAGCGGCCGTCGTCCCGAAACAAGCCGCACGCGCTGCTACGTACG
CTGGCCTGGACGTTGCGGCGCCCCCTGGCAGCCACCGTGTTCCCGCGACTGTGCGCCATCGGCTTCAAGTTTGCGCAGCC
GTTCCTGATCGGCAGCCTGATTCGGTATCTCGATGATGCCGCACCAGAGAACAACAACAGCAGCGGCCACGGCCTCATCA
GTGCATTTGCGCTGGTCTACTCGGGCGTTGCCGTCTCGACGGGCCTGTACTGGTACCAGGCGTATCGTACCATCACGATG
GTTCGTGGCAGCCTGATCGCCGTGGTCTACGCGCGCACGCTGGACCTGGACCTGGGCGCGCCGTCGCACGCGTCGTCGAG
CACGCTGATGAGCACCGACGTGGAGCGCATCTGCACCTGTATCGTGAACCTGCATGAGCTGTGGGCGAACGTGCTCGAGG
TGGGCTTAGCCATCTACATCCTGGCGACGCAGCTGGGAGGCGCCTGCATTGCTGTTGCCTTTCTAGCCTTGGGTGAGTCT
GGCAGGGAAGGATGGATAAGGTACAGCTTCGTAGATGGTCTGACTGACGCATCCTAGCCTGCGGTTTTGGAACGCTGCTC
CTCACAAAACCGATCGAGAAAAGACAGGAGGCATGGCTGAAGGCGGCCCAGAAGAGGCTCCGGGCCACGGAAGCGACGCT
CGGTTCGATCAAGAGCATCAAGATGATGGGCTGGACGGAGCCGATGCAAAATGTCATACAGGGCCTACGGATCGATGAGC
TTCGGCAGGCGATGCACTATCGCAAGCTCCAGGTCCTTAGCATTGTTGTCTGTAAGAAGCCACCCCAAAGACGTCCACTT
TTCCTAAACAGCTAGCGACTAACATCTAAAACACAAAGCTCTTGTGATGACTGTGGCTGGTCCGGCTACTGCTATTACCA
CGTTTACCGTCATCTCAGTCGTCAGAGGGGCCATCGCGCTATTGCCCTCCAAGGCTTTTACTTCGATTGCCGTCTTAGCC
TTGATCTCGACCCCTCTGATTACTCTGTTCCAGGCGCTTCCACTGCTCAAGTCCGCTGTCGCATCCATGACTCGTATCCA
GGACTTCCTTAATCAGCCCTGCCGCAAAGACAGTCAGCAGGGGAAGAACGCGACGCTTTTTCCGCAAAGCCTAGGCAGTA
GTACTGATATGGCCATTCCCATGGTGGATTTCGAAACAAATAGATCGGCCAGCAAACAAGGCCCCAGCCGCGGCGACGGC
AAGGTCGACGACCCGATCACCATGTCTGAAGCAAGCATGGGATGGGGCGACCACGGTGATAAGGTGGTCCTCCACGATAT
CAGCATCACCATTGCGCACGGAGCCTTGGCGATGGTCATTGGTCCTGTGGGCTGCGGCAAGTCGAATTTACTCAAGGCCA
TGCTCGGCGAGACCAGGGTCTGCCAGGGCGTTATCAATGTTTTGTACGAGGAGGTGGCATTCTCGGACCAGACTCCGTGG
ATGATGTTTGGCACCATCCGGGACAACATTACGGGCATGACGGGGCATGCCTTTGACGAGACCTGGTACCGGACTGTTCT
TCATGCCTGTGCGCTCGAGAAGGATCTAGAGCAGCTTCCGGATGGAGGCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62