GenePrediction:GLEAN_1804 Details

Name: GLEAN_1804
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1281600..1284196 (+ strand)
Length: 2597
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1281600..1281759 (+ strand)
Length: 160
Type: CDS
Source: GLEAN
Position: GCSC_144:1281809..1282153 (+ strand)
Length: 345
Type: CDS
Source: GLEAN
Position: GCSC_144:1282732..1283320 (+ strand)
Length: 589
Type: CDS
Source: GLEAN
Position: GCSC_144:1283544..1283930 (+ strand)
Length: 387
Type: CDS
Source: GLEAN
Position: GCSC_144:1283986..1284196 (+ strand)
Length: 211
>GLEAN_1804 class=GenePrediction position=GCSC_144:1281600..1284196 (+ strand)
ATGGCCAGGGTCCTGTATTCAAGAAAGAAACTCGTCATTCTCGACGACGTCTTCGCGGGTCTTGACAGAAACACAGAGAG
TCAAGTTTTTGCGCGTGTTTTCGGTCCTTCCGGACTTCTTCGGCAGCAGAAAATCACTACTGTTCTCGTCACAAACAGAG
GTAAGTAACAAGAACGAAAGACAAAAACGGAATCTTACATATATTGCAGCAAACCAGCTTGCGGCGAGCACCCAAATCAT
CGCTCTCGATCAGGCTGGCCGCATCTCACAACAAGGAGCGTACGACAAGCTCTGTTGCGTCAGGGGATACGTCCAGACCT
TGTCAAGCCAGCCAGGCTCGGGAGCCGCAGAACAGGACGACCTCACAAGCGTAGAGAAGACTATTGTGGCGCGGGCATCT
CCGGCTACTTCCAACACCGACCGGGTCGCAGAGCTTGCTCGGCAGACGGGAGATATCTCGCTGTACCAGTACTACCTCCA
GTTCGCTGGCACAGGCACTTTTATTCTCGCCGTCTGCGCGCTATTTGTTTATTCCTTCTGCATCGTCTTTCCAAGTGAGT
GGTCTGAGCTGTGACGTTTGTAAGAGTTACTCTGACCGGATACCTTGCAGCTATATGGCTTGATTGGTGGTCGACCGCAA
ACGAGAAACGTCCTGGCCATAATTTAGGCATGTATCTTGGAATTTACATCTTCCTAGGCGTGTTAGGTTTAGCAGCCTTC
AGTCTCTTTTGCTGGTAGGTGCAGGAGGCGATTCCCAACTACTTTGCATCGTCCTTAATCCGGTTTTCTTCTATCATAGG
CAAATGGTCCAAGTTCTGGCCCCGCAAGCTGGACGGAAACTGCACTCGACTATTCTAACAAGTGCATTATAGTAAGAAAA
CTGACCCCCCCCCTTAACAGCCTCATACGACTGACATGTAAAGTGCCCCATTGTCCTTACTTACGCAAACCGACGTGGGC
ACCATCTTGAATCGGTTTAGCCAGGACATACAGCTCATTGGTTTCCAAGTCACCCTAACCAGCATGAGTGCTGCCGAAGG
TGAAGAATGCCGCTGAGTCCTATCATTGCCGTTACCGCTAACATTCTTGGGACGCCTCCTGTCAGCGCTGAGTACAGCTA
TCTTCCGCTTAGTTGTCGTCTGTATAACCGCCAAATACGTGGCCACGGTCATGCCACTTAGCCTATTCGTCATCTACGTC
ATCCAAAAAGGCTATCTGCGGACCTCGCGCCAACTCCGCTACCTCGACCTCGAGGCCAAGGCCCCCATATACACACTCTT
TGTCGAGACGCTCGATGGCCTCGCCACCATCCGCGCCTTTGGCTGGCAGGGGTCCTTCCGCCGCCACGGCCACGAACTGC
TCGACGGTGCCCAGCGGCCGTTCTACCTGCTCAACTGCATCCAGCGCTGGCTCGGCTTCGTGCTGGACATGCTGCTGACG
GGCGTCTCAGTTCTGGTGGTATTTTTTGCCGTGCGGCTGCGCAGTCAGACGACCGGCGGCACGACGGGCGTGGCACTCGT
GAACATCCTAAGCTGCCACCAAAACCTGGCTGGCTTTGTCCTGCGGTGGACGCTTTTGGAGACGTCGATCGGTGCGGTCT
CCCGGATCCGGGCCTTTTCGCTACAGTGTCCGACGGAGCTGCGGGAGGCTGTCGTACAGCCGCCGGCAAACTGGCCTCAG
AGCGGGTCGATTCTGGTGCAGAACATTAGTGCATCATACAGGTGAGTTGCCTCTTCATCCTACACATTTTTCTTTACATT
GCATACTTACTCTAATCCGCTGTCTTCTTACTTAGCCCTGATAAACCTGTACTAAAAGATGTGACATGTTCTATCTTACC
CGGGTCGAAAGTTGGCATCTGCGGCCGGACTGGAAGGTATGTGGCCCTGCTATCAAACAATACTAGTCTCTATATACGTG
CTAAACCCTTTTTTATCGCTACAGCGGCAAGAGCTCCTTCATCCTCTGTCTCTTACAGATGCTAGACCTTGACGACGGCA
GTATCACCATCGACAATGTTGACCTCTCGAAAATAACGCGCGAGGCCGTCCGATCAGTCTTTGCCAGCGTTCCACAGGAC
TCTGTGCTCTTCGAGGGCAGCGTCCGCTTCAATCTCGATCCACGCGGCGTCGTAGAGGACTCGCGAATGCAGGCGGCCTT
GCGCAAGGTGCAGCTCTGGGACCTCGTCAATCGGCCGGGCAGTGATGGCAGCGGACTGGATTCGCTAATTGGCGATCTGC
ACCTATCCCACGGGCAACGGCAGCTCTTCTCCCTCGCCCGAGCCCTACTAAGCAAGGCTGAAATGTTGGTGCTCGACGAG
GCGACCAGCAGGTAGAATTCCATCTCGCTCTCCTTCGTTTGTATTAAGGCTGATGATCCACGACAGCATGGACAAAGAGA
CAAACAAGGTCATGCAGTCGCTCATCCGGAGCGAGTTTGCCGACCACACGGTTCTCTGCGTGGATCACCATCTCGAGAAC
CTACTGGACTACGACGTCATTGCCTACTTTGACGATGGTTCCCTGGTTGAATTTTCCTCGTCGAGCGTGTTGCTTCAGCA
GAGTAACTCTCGCTTTCAACAGTTATTGGAGGGCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62