GenePrediction:GLEAN_1805 Details

Name: GLEAN_1805
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1296202..1298402 (+ strand)
Length: 2201
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1296202..1296363 (+ strand)
Length: 162
Type: CDS
Source: GLEAN
Position: GCSC_144:1296416..1297218 (+ strand)
Length: 803
Type: CDS
Source: GLEAN
Position: GCSC_144:1297389..1297738 (+ strand)
Length: 350
Type: CDS
Source: GLEAN
Position: GCSC_144:1297789..1297886 (+ strand)
Length: 98
Type: CDS
Source: GLEAN
Position: GCSC_144:1297937..1298092 (+ strand)
Length: 156
Type: CDS
Source: GLEAN
Position: GCSC_144:1298151..1298402 (+ strand)
Length: 252
>GLEAN_1805 class=GenePrediction position=GCSC_144:1296202..1298402 (+ strand)
ATGGCATCAACCGCTGGGGGCTACAAGCAAATCAATAAGGCTCTCGATGTCCGCGCATTCGAAGGCTACCTCGACGGACA
GCAGACCCTTCTGCCTACGATCGCAGATGTTGAGCAGATCAGCCCACGGGGCATTCGTGTGATGGGCCAAAACCCGGAGA
AGGTACGGTCGGGGGTGATATGGGATGTATCATGGGAAGTCAACTAACAAACAGTTTACGCTTCAAGGAACCAACACCTA
CCTTATCGGCACCGGGCCGGAAAGAATCCTCATCGACACCGGTCAGGGATTCCCCACGTGGGCCGAGCTCATCGCGGCCA
CCTTGTCGGAGCATAACATCACCGTAAGCCATGTGCTGCTAACACACTGGCACGGTGATCATACGGGCGGTGTGCCGGAC
CTCCTACGTCTCTACCCGCATCTTAGAACCCGCATCTACAAGCACAGTCCCACCAGAACCCAGCAGCCGATTGCAGACGG
CCAGAAGTTTGTGGTGCCTGGTGCTTCGATTCGCGCCATCCACACGCCCGGGCACGCCCATGACCACATGTGCTTTGTGC
TAGAGGAGGAACAGGCCATGTTTACAGGCGACAACATCCTGGGCCACGGCACCGCCACCTTTGAGCATCTCGGTGTCTGG
ATGAAGAGTCTGCACATCATGCACTCCCATGACTGCCACCAAGGCTACCCGGCTCATGGTGTTGTTGTGGCCGACCTCGA
TGGCAAGATCCAGCAGGAGCTCGAGCAAAAGCGGCGTCGTGAGCGGCGCATCGTCGAATCGTTGCGGCTGCTGAAAGAGC
AAGACCAGGGGAGGCGTCGTGGCAGTGTGACGGTAAAGCAGCTTGTGGCCCACATGCATGTTAACCTTGACGTCGGCATC
CGCGAGACCGTGCTGGAGCCGTTTACCGAAGAAGTGCTGCGCAAGTTGGCCGAGGACGGCACGGTAGCATTTGAGATACA
AGCCAGGATGAAGAAGTGGTTTCTCGTGCGGCTGAACCTGTCTCGGGCATCGACTGTGTAGATTTGGGGATGTGGGGAAC
GGGGCATTGTTGGGGTCGCTTAAAAGGCTTATGCCCCCTGTGAACAGATTAAAAGGCTCGATGGCCTAGGGTATATCATG
GTCTCGCTATAGAGAAATGGTACACAACACTTTTGTCGATTTCTGGTTTTGTGTTTACTCTTAGCAGCGAAATTGCTGTT
CTCGATTTTGTCGCAACAATGCCGAAAATGGTGGCCAGTGGCATCCAAACAAATCCCCTATCTTTAGTCGGCAAAGTGGC
CATCGTCACAGGCTCCGGCAAGGAGAACGGTATTGGGGCCGGCATCTGCAGAACTCTTGCCCGCCATGGCGCTAGTGTTA
CTATAAACTACGTTTCTAAGGCCACAGAACCACGGGCCAAAGCGGTGGCTGAGAGCATCCGCAACAACGGCGGCCGTGCT
GCTGTGGTCCGGGGTAGCATCGACACCCCTGAGGGAGCAAAGCGGCTTGTGGACGAGACTTTACAATATTTCGGCGTGGA
CAATATCAACATTCTGGGTACGTTTTCATCTCCAGTGGCACCTTTCCTATTTTTAATAAACTTCCAGTCAACAATGCTGG
GCTGGGATCTTTCAGTCATCTCGTCGACGTAACCCCTGAGCAACTGCAGCAGGAGTTTTCCGTCATGGTTTTTGGCGCGT
TATACGTGCGCTAATTCTGTCTCCGGACAATTTTGCCTGGTGCTAACAATAGCAGATGACTCAGGCAGTGGTCAAACTCG
GCAAGATGCCCCCGGGAGGCCGCATCATCAACATTGGTTCCATTGCGTCCACCATGGGCCCGACCAATGTAGGCGTCTAT
GCAGCAGCCAAAGCGGCCACAGACTCGCTAATGGCGACGTTAGCTATGGAGGTAACAGCCGATGCATTCTATTTCTGCTT
CTGTGTATTCGAATTCACTGACAACATAGCTCGGACGGAGCCGCGGAATTACCGTCAATACGATTGCTCCAGGCCCAGTC
AACACCGACATTAGTAACGACGTGGGCGATGCAGCGACTGCTGACGAGCAAGACAAGATTTTTATCAATATGACGCGGGC
GGCTGGGCGCGTCGGCACCGTGGATGACATTGCTGATGCGGTTCTCCTGCTCGTGTCGGAGAAGAGCCGCTGGATCACGG
CACAAGTAGTTTCTGTCAGCGGTGGGATCATCATTCTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62