GenePrediction:GLEAN_1807 Details

Name: GLEAN_1807
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1303950..1307228 (+ strand)
Length: 3279
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1303950..1304459 (+ strand)
Length: 510
Type: CDS
Source: GLEAN
Position: GCSC_144:1304519..1304575 (+ strand)
Length: 57
Type: CDS
Source: GLEAN
Position: GCSC_144:1304625..1304721 (+ strand)
Length: 97
Type: CDS
Source: GLEAN
Position: GCSC_144:1304775..1304959 (+ strand)
Length: 185
Type: CDS
Source: GLEAN
Position: GCSC_144:1305021..1305201 (+ strand)
Length: 181
Type: CDS
Source: GLEAN
Position: GCSC_144:1305253..1305976 (+ strand)
Length: 724
Type: CDS
Source: GLEAN
Position: GCSC_144:1306367..1307228 (+ strand)
Length: 862
>GLEAN_1807 class=GenePrediction position=GCSC_144:1303950..1307228 (+ strand)
ATGACTTCCAATTATCTGCCGGGAAACGTACAACATGCAACGGCTGCACCATCCGAACTTGCAGCCACTGCTGCTGGAAC
TGACTTTGAAACCTGTATCTCAAGATCCAAGACAAGCAACCCTCAGGATGCGGATGAAGACACTAAAGCTCTGACGGAAA
CGATGTCTGGCTGGAAGGTTCTCCTCGTGGTGATGGGCATTCTCATGAGCATGTTTCTCGTGGCTCTAGACCGTACCATT
GTCTCAACAGCCATCCCCCAAATCACTAACGAGTTTCACGCCCTCAACGATTACGGCTGGTACGGTAGCGCCTACATGCT
ATCGTGCTGTGCCGTGCAGATGCTCTTTGGCAAGGTCTTTACCTTTTTCTCCGTCAAGTACACCCTCTTCCTCAGTGTCC
TTACATTTGAGGTGGGCTCGGCTATCTGCGGTTCGGCACCCAAGTCAATTGCCTTTATCATCGGCCGGGCCATCGCGGGC
ATCGGTGCCGCTGGTATTTTTGCTGGGGCGGTTCGTTTTTCCTATGATTTGGTTTTTCTTTTCTCGATTGGCATACACTG
ACAATACAGATGACGTCTATGATTCACGTGGTGCCTCTGCACCACAAGCCAAAGCTCTTTGCGGCAGTGAGCAACCAAGA
CTTGTTTTAGAAATGTAATATACTAACAATCTTAGATGGGTATGATGCAGGTTGTCGCACAAATTGGAGGTCCCCTGATC
GGAGGAGCATTTACATCACGCGTCACATGGCGCTGGTGTTTCTATGTGAACCGTGAGGCCCGAATATATGCACTACTGAT
AGTCATCTGCTAACTCGTCGAATAGTGCCAATTGGTGGTGCCGCCATGATTGTCATTCTTCTTTTCCTCGAAATTCCCCA
GCAACGTCAATTGAAAAACAAACCCCTGAAGTGGAAGATGCGGCAGCTGGATTTCCCCGGGACCATTTTGGTGGCTTCTG
GAGCCATCTGCATCCTGCTGGCTCTCCAGTGGGGCGGCCAGACATATGCTGTGCGTTGTTTGCCTCTGCAACCGGTGCCT
TGTCGATGCGTACTAACTTAGTTGCATATAGTGGAACAATGGTCGCGTTATTGCTCTTCTCATCATTGGCATTTTCTGCC
TGATCGGCTTTGGCCTCATCCAAGTGTTCTGCCCAGACACCGCCACCATTCCCCTGTATCTATTCCGCAACAGGAGCGTC
GTCGCGGCTTGGTTCCTGTTTGTATTTTTCAGCTGCTCTAACTTTGTCTTCAGTATGTACTTCAGTGTTCACTCCGGACG
TCACTCCTACTAACAAGCCAAAGTCTATTTCATTCCCAACTGGTTCCAGGCCATCACGCACGTTTCATCCGTGCAGTCTG
GAATCCGCACTATTCCGCTCATGGCCTCATCCATTGTCGGCCTGATTCTTGGAGGTATCCTGACCAGTAAAATAGGGTAC
TATGTGCCATTTGCTATCCTCGGTGCCGTCCTCTCTTCCATCGGCGGCGGTCTCATCTCTACCTGGACTGTCGACACACC
GATGTCGAAATGGATCGGCTACCAGATTGTCAACGGCATTGGCGTCGGGTTTGTCTACCAGATTCCTAATCTCGCCATCC
AGGCGGTCTTGCCTAAGAAAGATGCCCCCACAGGTTTCGCCACTGCTCTCTTTGGCGGCCTTCTTATGGCGTCTGTCTTT
GTGTCAGTAGGTGAAAACGTGCTTGCCACCCAGCTCGTTAGCCGACTGTCCAAGTTGACGGGAGGCCCTATTGACCCGAG
TCTCATATATGAGAGTGGTGCAACCACGCTGTTGAACAACCTGCCGGCCAACCTACAGGAGGCCGGACTTGTCGCCTACA
ACGACTCGCTGCGTGTAGTTTTTCAGATCGGAATGGCCCTGTCGTGTGTTTGTGTCCCTGGTGCCTGCGCCCTGGAATGG
AAGAGCGTGGCTGCACCATGGGCAAAGAAGACCGAAGAGAAGGACGCGAAAGCGAATGAAGCAGCCGAGGAATCGGCCGA
GGCAGGAAGATATAAGGAAGAAAGAAAGTGTGCGGTATAATCGGCATCATGGAAAGTAGGGGACAGGGCTTGAACATAAT
TTTACTGGGTTTATTATGTGTATATAAGAAAGGTATTATATATCCGCTGGTGGCTTGATGAATAGTACGCCACTGCTCTC
TTCTCTTAGTGTCGAGCCAGAAATTGCAAGGCATAAATCGCACCAGGGATTTGAGACCAAGTTTAAACTCGCTTGTGCTC
TGTTATCCGGGTGTTCTTTTTCTTTGTTAATGACAGATCCCGATCGGTCGTTTATTTTGCCGACACAAATAGTATATATT
GACATCAGGGACGACATGCTCTTTCACAGTACCATATCGAATCAATCTATTATCTACAACGAACGCACAAAATGTCATTC
TTCCAATCCCTTCCCAGACTCACCAAGACCTACCACACATCGTCGTACGGCCGCATAGCCAATCACCATGGATTTGAGGA
CCACGGCAAAACCATTTTAATCACCGGCGGTGCCAGTGGTGTGGGCTATAGCATCTCTAAAGCATTTGCTGGTACGGGCG
TTGCACGCATTGCTATTCTGTCCCGCTCGGCAGACGCCCAGGCAATAGCCAAACGCGAACTGGATATGGCTTTTCCCGCC
ACGCAGATTCTGATATATGCTGTTTCAATCACTGATACAGCCTGTGTCGTTGCCATCTTACAGGAGCTAGGGACTGTCGA
CGTTCTAGTGCTGAATGCAGCCGTCGCCCACCGCCGGGCAGCTGGCACCGATATCACTGTGGACGAAGTGCAAGAGGCCT
TTGATACCAACATCATCGGTCCTTTTGCGCTGACCAAGGCCTACCTGTCGCAGCCCACACCCATACGCAAGACGGTGCTG
CACGTGTCGTCCGTCGCCTTACAGCTTTCGGGTTATCGCATCGGCTACGGGCCCAGCAAGGCAGCAGCAACACAGGTCAT
GCAGCACTTTGCGGCCGAAAGAAAGGACGATGGCAACACCAAGATAATTTCCTTTCACCCAGGGACCATCTGGACACCGG
GCACGGAGAAAGTACTCGGCGGGATCTTCAGCAAGGATGCCAAGCACTGGGAGGATATCGATCTGCCGGCGCATTTTGCG
CTGTGGCTAGCAGGGTCCGAGAGTGGGTTCTTGCACGGGCGGTTTGTGTGGGCACAATGGGACGTCGATGAGCTGCTGGC
TCTGCAGGATCAGCTAACGCCAGAGTCGGACGTGTTGAAAGTCGGGTTGATTCTGCGGGAAACCAATGAAACTACCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62