GenePrediction:GLEAN_1808 Details

Name: GLEAN_1808
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1308053..1308433 (+ strand)
Length: 381
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1308053..1308393 (+ strand)
Length: 341
Type: CDS
Source: GLEAN
Position: GCSC_144:1308421..1308433 (+ strand)
Length: 13
>GLEAN_1808 class=GenePrediction position=GCSC_144:1308053..1308433 (+ strand)
ATGCCGCGCTATTTTTGTCTAACCATCCTGGGCTACCGCAAGCCAGGGATGAGCGAAGATAACTACCACAACCACATGAT
AAACGTGTCGGCCCCTATGACAAAGGACCTTATGGTCAAGTACGGCATTCAGCGCTGGACACAGATCCATAACAGCACTG
CCACGCGAAAGCTTGTGGAGCAGCTGATTGACCCCCAAATGGTCAACACCTCGGATGTCGATTGCTTTAGCCAGGTTGTC
TTCCGGTCTGTCGACGACTACAAGCGCATGAAGCAAGATCCTTGGTATAAGGAAAAATTGGCCCGCGATCATGGCAACTT
TGCCGACACTCGGAAGAGCTTGTATGTGAGCGAACAGTCGTTTCTTAGCGTTTGTGCCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62