GenePrediction:GLEAN_1809 Details

Name: GLEAN_1809
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1311924..1313841 (+ strand)
Length: 1918
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1311924..1312202 (+ strand)
Length: 279
Type: CDS
Source: GLEAN
Position: GCSC_144:1312324..1312899 (+ strand)
Length: 576
Type: CDS
Source: GLEAN
Position: GCSC_144:1313103..1313339 (+ strand)
Length: 237
Type: CDS
Source: GLEAN
Position: GCSC_144:1313608..1313841 (+ strand)
Length: 234
>GLEAN_1809 class=GenePrediction position=GCSC_144:1311924..1313841 (+ strand)
ATGGCATCTGGCACCCGACAAGAGCGTGACGATATAACCATGAACGCCCACACGCTGGATGAGCTGCAGACGCAGAGCGA
CAAGCTGGCAGCAGCTGTTCGGGTGCTAGGCTATAATCTGCACTCGCAAGAGGCGTTCTCCTCCGAGGCTACGGGCGACA
TACTATCGGAGACAAAAGCGAATATTGCAAAGGCCAAAGCTGACATCCTTGCCGGCTTGGAGGGCATCCGGGCACTGCTA
GACGGTCCAGACGAGTTCCTGAGCCGTCTCACCATCCAGGTCAGATCCCATCTGCACGTTTCCTTTGGGTACCACGTATT
CGCACGAATACAACCCCCGATAAGCTTTCTGGCGCTTTTAGCGACACGGGTTGACACTCCTACATCTTTGGTATGTGCAG
GTGCAGATATTGGCCTGCCTGAAATGGCTTAGCGACTTTCAGATTCTGGCCTGCATCCCGCGAGAGGGAAGCTTGCCTAT
CAGCGATTTGGCCGATCTAGCGGGGGTACCCGAGGACCAGTTGCGCCGGGTGATCCGTTTGACGGCGGGCTGCCGGTTTC
TGCGTGAGGTACAGCCGAATTGCGTATCACATACAGAGCTCTCGGGACAATTCCTGGCCCGCCAGCCTCTCTGCGACGCG
ACGAATTTCATTGCCAACACGGTTGCCCCAGCTGCTCTACACATGAACACAGCCACGCGTCTGGCCATGGCCTCGATTGA
CACGGATGGAGGCATGAGCACAAAGCAACCCCGTTCGCGGAGCCACAGCGAACACCACCCAGCTGGCCAGACAGCCTATG
ACATTGCTCTCAGGCCCATGCAATCTTTTCATGCTGCACTCCAGGAGCCATCCAAGCTCGCACGACAATGGACTGCTTAT
CTTACGCACGCAGCACATCTGCATTCCGAAGATGAGCTCATCAATGCTTTCCTGCGTCTTCAGTGGCCGAGCTTAGGCAA
TACCTGCATAGTGGAGGTAAGGCCAACCGATTTGCAACCAATTCTCGCTTCACTTCCCCTCATCCTTCTCCTTGCGCTAT
TACTGGGGTTTCTTGTTGTTGTCTTCCCTCTCACAGCAGTCGCTTCACTCCCAATCACAGCGAGACTAACTGCTTTTAGG
TCGGGGCCCAATCTACGTCATTGGCCCACAAACTTGCAAGGACTTTCGCCAATCTGCAGGTGCTGGTGCAAGTCACCGAC
CGCAATACGTTGGCCTGCATTCAGGAAAGAAGCAGTGGGGACGAGCTGCACCATATAAACGGCAAAAACAGGGACAGCGA
TCAAAATAGCAACGCAACCGAGAGCAACGCCGACACCCGGACAAAGGTCACTTTGCGCCAAGTTGGCTCGCTGCAGCCCG
TCACCACTGCGACTGTCTACATCCTGCATCTTCCGCCATCATCGTCAGCCATCTCCGTAAGCCATTATCACAGCTCCAAG
GGTTGCTGCGAGTCGGTCAAATCTTCCCTTTGGGTGGGGCGAAGATCTTATTTAAATAGTTAATACTATTATTTAAAACT
GCAATATCATAAGGTAATATTTGGAATAATGGGTAATTAAATAAAATAGCTACACTTATTGCTAAAGGTATACTATTACT
TGTATGACTTTACTTGTATGACTTTGTAATTCCCTCGCACCACTGCGGATTGGTGGTGGAATCATGCTCGTGCTTACGGC
ACAGCTGCTACCCGCGCCCGGCAGCCTAGACGGTCACTGGGGGCTGGAGGCAGCAGTACGAGTGCGCGATTTAAGCATGC
TGCAGCTAGCCAATGAGGGCGAGATGGAAATGGCCGAGCTGCTCGATATTGTGGAGTCGGTCACAGACAACGATGGCAAG
CTGGTGGTGGCCAGTGAGCTGCGGTCGCATGACGGGCTTGTGTTGGCCTTGGTGCTAAAACACAAGTACCACGGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62