GenePrediction:GLEAN_180 Details

Name: GLEAN_180
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:29331..32032 (+ strand)
Length: 2702
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:29331..29695 (+ strand)
Length: 365
Type: CDS
Source: GLEAN
Position: GCSC_167:29779..30816 (+ strand)
Length: 1038
Type: CDS
Source: GLEAN
Position: GCSC_167:31469..31505 (+ strand)
Length: 37
Type: CDS
Source: GLEAN
Position: GCSC_167:31589..31658 (+ strand)
Length: 70
Type: CDS
Source: GLEAN
Position: GCSC_167:31869..32032 (+ strand)
Length: 164
>GLEAN_180 class=GenePrediction position=GCSC_167:29331..32032 (+ strand)
ATGTCAACACCAGCTGAGATGGACAAGGACGTGGAGAAAAGCATTGACGGAGATTGGCTGCCACAGGAGAACGTGCACAT
CCACCGCCACAACTCTGCCGTCGACGTGCCGCTGGGCCGGTCAAAGTCAGATGCCGGGCTCGACTTCGGCGCCGGTACCC
GGTCCGTGGATGTGTCCGGGGATGAGGACGACGACCTGCAACAGGGCGGCAATCAGGCCGGCGACATCGAGGCGGGCCCA
ACCGAGAAGGACGCGTTCGAGGTGTCGTGGGACGGCGGCGACAGCGACCCGGCAAACCCACGGAGCATGGCCACGGCGCG
CAAGTGGCTGATCGTGACGGTGACGTGTGTAGGGGCGACGTGTGTGTAAGTCTGGTCTTGTGCGGTCTTGTCGTCTTGAA
GTCTTTACTATGTAAGATACAGATTCGTGACTCATGCTGACTAATCAGAACCTGTGCGAGTTCCATCTACACGTCGACAT
ACGAGCAGATGGACGCCGAGTTTGGCAACTCGCGCATTGTGGCGACGCTAGGACTGTCGACATTTGTGCTGGGCATTGCG
CTGGGACCGGTCTGGAGCCCACTGAGCGAGTTCTACGGTCGCCGACCGATCTATCTGGGCTCGTTTCTGCTGTTCCTCGT
GTGGATCGTGCCGTCGGCAGTGGCTCGGAACATTGAGACGATGATCATCGCGCGTTTCTTCCAGGGCTTTGCCGGCAGCG
CGTTCCTGTCGGTGGCGGGCGGCACGGTGGGCGACCTGTTCCACCGTGAGGCGATGCAGGGCCCGATGGCACTCTTCTCG
GCAGCACCCTTCATCGGGCCTGCGATCGGGCCACTGATCGGCGGCTTCGTCAACACGTACGCCAGCTGGCGCTGGACGCA
CTACCTGCTGCTGATCTGGAGCGGCTGCGCGCTGGTGGCGCTGCTGCTGCTCGTGCCCGAGACATACCACCCGGTCCTGC
TGCGGAACAAGGCTCAACGACTGCGTCACGAAACGGGCGACGATCGCTGGCGCGCGCCGCTCGAGACGCTCAACGCTCAC
CGCTCCGTGGCCGCGACGGTTGGCCTCGCGCTGCTGCGGCCCTTCCAGCTGCTCATTTTCGAGCCCATGTGCCTGCTGCT
CAACCTCTACTCGGCCATCCTGCTGGGCGTGCTCTACCTCTTCTTCGGCGCCATTCCACTTGTCTTTGAGCACGCCCACG
GCTTCAATCTCTGGCAGGTCGGCCTCGCCTTCCTCGGCCTCCTCGTCGGCATGCTCATCGGCGGCCTTTCTGCTCCCCTC
TGGGGCCATATCCGCCTCGGCCTCATCCGTCGTCGCCAGGAAGCCTCCGGCGAGTCTCTGCCGCGCAGCGAACCCGAGGA
CCGTCTGCCCTCGCTCATGGTCGGCTCCGTTCTCGTCTCCGTCGGGCTCTTCTGGTTCGGCTGGTCTACGTACCCGCACG
TCCACTGGATCATGCCGATCATCGGCTCAGCCATTTTTGCTACAGGGTATGATTTTACTTGTTTTTGTCTTCTTCCCTTC
ATTGTTGCTTTTCATATCGTTTTATTCTTTCTGTCTCTTTCTTTCTCCTTCTTCCCATCACTCTGTAGCTCCCTATCCTT
TACCCCCCACCCTTGTCATTCTATTTTCAGAACAAACGCCACACCAGCAAGACATTGGCTCGCCAACAAGCAAAAAAGCC
CTGTCACTGCTTCCGCCTTGATCCCGCCTTTCTCTATATTGGCGGACAGGGTCTCACGCCCCCACTTTGCGGCTGTGTGA
TGTGATGGGAATTCCTCACGGCCCATTCTTCCAACTGTCACCCCTCTCACTGCACCTTGCTCTATATTTGCAAATTTTCT
TTCTGTGCTTGACCAAGCTGCTGTGCTCTGCGACCACTGCACATGCAACCCCTTTATCTCGCAAGTTGGCCAATCTCCTA
TCCAGAACGGCCGTCTTCCAAGCCTCTCTTCTGCCTAAACATCTCGTGTCTATTTCTATATCCTTGTTTTCCACTTTTCA
TACGTGGATTGTCACGCAGCAACTGCTGCCTGTCGCTGCCCATGAAGACATCAATGCGCTCTTTTCTCTTGCTGGGCTCA
TTTGGCTGGCAGTTCGTGGGACAATGTCGCTAATCGCACGCCTTGCTCTGCACTACAGGACAATATTGGCTTTCAGCGGC
ATATTCACCTTTCTTGTAAGTGTCCCGCATGCAATGGCACAAGAAAAGAACACGACGAGATTGGCTAAAATGCGAGGCTT
ACACACTGGAACACATAGGTCGAAGTTTATGTGCTATATGGGGCCAGTGCGCTGTCATCGAATGCCCTTGTGCGATGTAC
CTTTGCTGGTAAGTGCTTTCCCTCTTTTTCTGTACTCTCCCTCCACGGCTCCGTGTCCCTTCTGTCCTTGCTCAACTGGC
GGTGTCTCGCGTTTATCTCCATCGAGTGGTTGTTCGTCTCACCACCGTCGACTTCTCGACCCACACAGCTGGGTTTTCGT
GTTCAATTTGTGCATCTTATTGCTGTCCCTATATGCACCTGATGCTAACATTTCGCAGCCGCCTTCCCACTCTTCGGCCT
GCAGATGTACAACAAGCTGGGCTACCAATGGGCTACATCGCTCCTGGCCTTCCTCACTGTGGCGATGCTGCCATTCCCCT
TCCTCTTTTTCAAATATGGCAAGCGCCTGAGAAGCAAGAGCCGCTTCGCGGTCGCGAATTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62