GenePrediction:GLEAN_1812 Details

Name: GLEAN_1812
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1321846..1322409 (+ strand)
Length: 564
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1321846..1322409 (+ strand)
Length: 564
>GLEAN_1812 class=GenePrediction position=GCSC_144:1321846..1322409 (+ strand)
ATGCCTACTCAAGAAGTCTGTATCGTCCCGACCAAGCCGGACAACTTTCGCCTGCCGAGAGAACGGCTAGGTATTTCTCG
TCTGGATACCGGGCCTGACAAGCCCGGCTCCCACGATATCGTCGGGGTCCTTCTGCAGCAGAACCATGACAAGCACCACA
TGTATTTTCGTGATATTGCGGGCCACAACCACATTCCGCACGCGATTCTGACTACTATGGCTATGGGCGGTACGGTCAAG
GAGCTGCGGCGCGCATACGACGATGGCGAGGCAATCCAGCGGCCCAAGACAGCACCTGATCCCATTGCCGTCGGCGAGAT
GGAAGATCCATTCAAATTTCTCGACCGCATGCAGGAAATCGAAGAGTACTCAAATTTTCTTGCCTTCTTTGAAAAGGAGT
TTGAGGCCAATCAAGGGCAGTGGCAGGATGTTTTCAATCACTTCGTTTTTGCCCGCAATCCGCAGTCGGACTTCTTGCTT
GCGCAGATGTTCGAAGGCCTCTACCACCCGCTGATCCACTTGAGTTTCGGTGTCGAGTTTGAGCTTTCAAGGGCTTGTGG
CTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62