GenePrediction:GLEAN_1815 Details

Name: GLEAN_1815
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1336294..1337669 (+ strand)
Length: 1376
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1336294..1336448 (+ strand)
Length: 155
Type: CDS
Source: GLEAN
Position: GCSC_144:1336538..1336704 (+ strand)
Length: 167
Type: CDS
Source: GLEAN
Position: GCSC_144:1336840..1336903 (+ strand)
Length: 64
Type: CDS
Source: GLEAN
Position: GCSC_144:1336960..1337011 (+ strand)
Length: 52
Type: CDS
Source: GLEAN
Position: GCSC_144:1337064..1337152 (+ strand)
Length: 89
Type: CDS
Source: GLEAN
Position: GCSC_144:1337210..1337669 (+ strand)
Length: 460
>GLEAN_1815 class=GenePrediction position=GCSC_144:1336294..1337669 (+ strand)
ATGCCGGACCCGGCCGATATCATCGAGCCTGGCCTCGAAGACAACTCCAGTGGCACCGGCGAGTTCGAGCCGCTCGAGTA
TACGGCCGACGAGCCAAGTTTGCACCAATGTCTTGGCTCGGCAATCTACAGGCACTCCTTTGAAAATGGCAGAAGGTGGC
CCTACTCTTCCTTATCCCGCCCCCCTTTTCCAGCTGTCGTTACTCGTAAGCAATAGTAGCTCACAAATGTCCTCTTCTCA
TCAGGTACCACTACTTTCGAAATGGGAAATACCCGATACCCAACGACGACATTGAGCAGACCCGCGACGACATGAAGCAT
GCCCTCCTACTGGAACTCACAGGCGGACAACTGATCCATGCCCCTATCGGTGACAACCCTCAAAAAATCATTGATATCGG
AACTGGAACAGGTATTTACCTCGGTTCAGAGTGTTCCTCGCACCGTGTACTAACACCGTTTTAGGCATCTGGGCAGTTGA
TGGCAAGCTGAGACTAATTTCATAATAATCACTTGCCGTTTACAAGCTTGCTAACTATCTTTGCAGTAGGAGATAGGTAT
CCTAGGGCCGAAGTCGTCGGTGTTGACCTCTCCCCTATTCAGCCAGTCTGGTAAGCTGTTTGCCACCCACTCCACATAGC
TCACATTCTAACCAAAGTCAAACCAGGCTGCCACCGAACGTCAAATTCATCATTGATGACGTCGAAGACGAGTGGTTGGT
AAGAGCAAATTCCGAATCCGCCAATCGTATCTATGGCTAACGGCAAGAAGACGGTCCACAGGAAATACGAATATGTCCAT
GCTCGGAACTTGATATCCTTCACCGGCAACCCCTCCAAACTATTGGCCCGATGTTACGAGTGAGTCACCACCAGATACAC
CTGGTCGACCTCAGCTGACATGTGGTTCCAATAAAGGAACATGAAACCTGGGGCCTGGATTGAAGTGAGCGACTTTGGCG
CTGACGTCCTATGCGATGACGGCACCATGCCCCCGGATTGGCCCTTGAAACAGATGTTTGGTAAGCTGTCTGTGGCGATG
CACAACCTCGGGAAAGATATACAGATTGCGCCACAGGTCGGACAACTCGTTGAGGAAGCCGGCTTCGTTAACCTTACGCG
GAAGGTGTACAAGGTGCCCGTGGGGATATGGCCGGCCAACAGGACACTGCGCCTTGTGGGCATGTACATGCGCCAGGTGA
CGGAAGATTTCCTGGACGCCGTGGCTGCGAAGCCATTTCGGACACTTGGTATGACTGAGGAGGAGATTTCAGCATTCATG
TCCAGCGTCTTGGAGGCACTGTACGACCGGTCCGTCCACAGCTACAACTGTTACTATATCTGGGTGGCTCAGAAGCCGGT
CGATGCGAAAGACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62