GenePrediction:GLEAN_1818 Details

Name: GLEAN_1818
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1349583..1351354 (+ strand)
Length: 1772
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1349583..1349736 (+ strand)
Length: 154
Type: CDS
Source: GLEAN
Position: GCSC_144:1349803..1349877 (+ strand)
Length: 75
Type: CDS
Source: GLEAN
Position: GCSC_144:1349947..1350160 (+ strand)
Length: 214
Type: CDS
Source: GLEAN
Position: GCSC_144:1350227..1350412 (+ strand)
Length: 186
Type: CDS
Source: GLEAN
Position: GCSC_144:1350468..1351116 (+ strand)
Length: 649
Type: CDS
Source: GLEAN
Position: GCSC_144:1351175..1351354 (+ strand)
Length: 180
>GLEAN_1818 class=GenePrediction position=GCSC_144:1349583..1351354 (+ strand)
ATGGGTTTGGGCACACGTTTTGCGGAGTTTATCCGCTGGTATCCTCGTGGCATGTCGGCCGAGGAGAGACGTCTTGTCGC
CAAAATTGACTGGCTTGTGTTGACTTACGCGTGTCTCTCGTTCTTCACCAAGTATCTGGACGTGTCCGCTCTCAGTGCGT
GGTATCTTATCTCATCTCATCTCATCTTATCTCAAACCAGTAACTAACATCACAAATTAGGCAACGCATACGTCTCTGGC
ATGAAAGAGGATCTGCACCTCACAGGCAACCGGCTTAACTACATCAACGCAGCTTGTATGCCCCATACCCACCTCCTGTA
ATGGACCAGAAAAATGAGAAAATTTTCTGACACACATTGTGTAGACGAAGTCGGATACGTCGTCTTCCAGGTACCAAGCA
ACATCCTCGTCACCAAGATCCCGGCCCACTACTACCTTCCGGCCGTGGAGATCTTCTGGGGCATGTTTACTCTGGGGACG
GCATTCATAAAAAACTACAATCAACTGGTGGTTATGCGCTTTTTCGTCGGCCTAAGCTCCACTGCATGCTACATCGGCTG
TCTACATGTTATTAACTCGTACGTTGCACGGCACAAAAGGCCATTTATAGGAACCACAAGCTAATCACTCCTCTCCAATG
TCAGCTGGTACAAGCGCAATGAGCTCGGCAGACGCAACGCCCTGTTCTGGTGCGCGAACCCGCTCGGCACCATGTTCGCT
GGCTATCTGCAAGCGGCCGCCTACAAAAACCTCAACGGAAACCACGGCCTCGAGGGGTGGAGATGGTTGTTCATTATATG
CACAATCATTACGATTCCTATCAGCATCGTGTACGCGGTCGTTCTAGGATCCTGCTGAAGGAAGCTCAGCTAACAGATAC
AACAGCGGTTTTGTCTTTTTCCCCGACATCCCTGAGCGGACCACCACAAGGTGGCTGACCGAGGACGAGAAGAAGCTCGC
ACGCAGCCGTGTTGAGGCCGACGGCTTCATGCCGACGCTGGGGCTGAACAAGAGTCTCTTCGCCCGCGTGCTCAAGATCA
AAGAGTTTTACATCTTCGTCCCGCTCACCGTCATCTTCTTTACCTGTCTCTACGGCTACAACACGCCCTATCTCCTCTGG
CTCAAGTCTCAGCATGGCCGCTACTCCGTTCCCAAGGTCAACGATCTCGGCACCGTCTCTTCAGCCGTATCTGTCGTCAG
TGCCATAGCCGTGTCCTACTATACCGACCTGAGCGGCTCGCGCTGGGAGGCTGCCACTCTGGCCGGCATTCTCTGCGTCT
TCTCCAACGTTGTTCTTGCCGTGTGGCACATCCCCTATGGCCTTAAGTTCTACGCATACATTGCGCTAGGTGCCGCGCAC
GGCGTCGGGCCGCTGCTGGTCACCTGGACGGCCGAGGCGCTGGCTGGCGATCTCGAGACCCGCTCCATCGTGTTTGCCGT
TCAGAATACTCTCGGCGAGGTTGCAGGCCTGGTGGTTCCTCTGGTGGTTTGGCAGGTGTCGCACTCGCCAACCTTCCATG
GCGGCTTCATCTGGGTGAGTTTTGAAGTCCTTTCCCGACTACCTTTGATTTCCTAACACCGAATCAAAATAGGCCACATG
CATCAGTGGGCTCTTCCTTGTCAATGTCGCTGTTATCACAATCTGCCAACGGCGCGATAAGCAGCGGGCGACACAAACAG
CCGCGGAAGAGACTGGCGATGTAAATGGCATGTCCCTCGAGGAGGAGAAGGCTGTCGATACGTCCAGCAAAGAGATTCGA
GAAACGAGTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62