GenePrediction:GLEAN_181 Details

Name: GLEAN_181
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:36232..38923 (+ strand)
Length: 2692
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:36232..36550 (+ strand)
Length: 319
Type: CDS
Source: GLEAN
Position: GCSC_167:36619..38807 (+ strand)
Length: 2189
Type: CDS
Source: GLEAN
Position: GCSC_167:38900..38923 (+ strand)
Length: 24
>GLEAN_181 class=GenePrediction position=GCSC_167:36232..38923 (+ strand)
ATGATGGACGAGATGGACACCAACGAGGGAGAGCTCTCAGACGCCCTATCTGAGAACGAGTACGACGACGTACACTTGCA
GCTTCTCGGAGAGAGGGATGATCACGAAGACCACACCGACGATCACCAAGACGACGATCACGACTACGACAGCGCCATGG
ACAAGCGGACAGATTCCAAGTCCATCAAGACGGAGGCTGGACTGGAGAGTACTGCCCCCGAGCCTAAGAAGAAGTACGAT
CCTAAGGACCCTCTGCGTCCTCGGAGGAAGAAGGCTCGCCGTGCCTGTTATGCGTGCCAGCGGGCTCATCTGACTTGTGG
TATGTCCTTCTGACGCTACGTTCCTGCCCTTTTTGGGCTGTCCTGTGTGAATGCTGACGAGACAAAGGCGATGAGCGTCC
GTGCCAGAGGTGTATCAAGAGAGGCCTCGCAGACGGCTGCCAGGATGGCGTTCGCAAAAAGGCTAAGTATCTACACGATG
CTCCGGCAGATGCCCTGCGACCAGTGCTGGGCCCCAACTTCAACGCTGGCACAACGGCGGCCGTGACGACGACGACGACG
CCATCTCGAACCAACGGCCATCGTCACCCGTCCAGCGCCGGCTCCGACGTCTCCGTGTCCAACGTCGGCACCTTTTACGC
TCAGTCCAACACGGCACCCTACAGCGTGTTCTCGTCGGGTCAGACTCCCTCAGGCACGCTGGCCGAGAATCTGACGTTCC
CGGGACCACAGTCGCCCGTCTCGCCCAGCTTTGTGTCGACGTCTGGAGCAGACGGAGCTGCCGCCCAGATGAACCGCATC
GATCTGACAGCAGCGGCAGCGGCAGCAGGCCTGAGCAGCTTCTCACCGGCCCTCTTCGATCCTAGCAATCCGGCGCTGTT
CAACTTCAACCTGGAGGGCATCAACTTTGGCAGTCAGTATGCAGCTATGGAGTTCGACATGCTGGGCCACATGTCCTCTG
GTGCAGCCGACGACGCAAACGACCCGACGTCCTCCCTCTCCCAGCAGCCTGGCGGTGGTGTGGGCGGCTTTCCCCCGGCG
GACGTCTTTGGCGGCGGCGCGAGCCAGACGCTCTTCAGCGGCGGTGCCTCGGGCACGGCGAACGGGCTGGTGAACGACTT
CATCGGCCTGGACTCGTCGACAAACGGGTTCTACTCACAGGGCAACCTCCAGCACGGTCTCCCGCACGCCTACGCCATCG
CTGCGGCGCCTCCGAGCCTGCAGAGCCCTAGCACAGACAACAACAGCCCACAAGCGACCGGCTACGGCTTCGAAGGATCT
CCGACCATGGCGACATATGCCGGTTCCACCGGAGGTGTAGCCAACGGGAACGGCCATGTGGGCCAGGTGCTGAGCGGTGT
CCGGGCTTCAGTGGCTCAGGCACAGCAGCAGCAGCACCAACAGCAACAACACCAGCACCAGACCCCACACCAGCACCAGC
ACCAACTGCAGCAGCACAAAGCTAGGTCGGCCATGGCAAAGCTGCTGCCACAGTCGATTCTGGGCAAGCGACACCGAGAC
CCGTCGTCGGTGTACGAGATGGTCAAGGAGCCGCACATGTATGTGGCCGGTTTCCATCGGCTCATCGCGCTGTTGCAGCG
ACGGTTCTCGGCCAGCAAGATAGTGCGGATCGCCAAGGCGCTGTCGAGCATCCGGCCGTCGTTCATCTCGTGCACGCGAA
CGCTGAACCGGCAAGACTTGGTGTTTATGGAAAAGTGCTTTCAGCGCACGCTCTTCGAGTACGAGGAGTTCATGTCGCAG
GTGTCGAGCCCGGCGATTGTCTGCCGGCGGACAGGCGAGGTGGCTGCCGTCAACAAGGAGTTCACCGCGCTGACGGGCTG
GACGAAGGAGGTGTTGCTGGGCAAGGCGCCCAACCTGAACGTGAACATGGGCCTATCGTCGGCCGTGGCAGCGGCAGGCG
GTACTGGAGCGGGATCCGGTGCTGCAGCCGGAGCTGGAGGCGGAGCAGCTGGAGCAGCCGGCAGCGTGTCGGTGGGCGGC
GGTTCATCAACGGGCAGTATGGACGTCGGTACGACCAGCAGTAACGGCAACGCCAACAGCAGCAGCAGCACAAACGGCGG
AACGAATAGCGGGCGATCGGGACTGTCGACGCCGCGGTTGCGGGCGCTGAACGCCGAGGCAATCAAGGCGTCAGAGGGCA
AGGCGCAGCCGATGTTCATTGCGGAGCTGATGGACGACGACAACGTGATTGAGTTCTACGAGGACTTTGCCCATCTGGCG
TTTGGCGACAGCCGCGGGTCGGTGAACCGCAAGTGCCGGCTGCTCAAGTACCGGACGCGGGAGATGCTAGACAGCTCTGC
GGGCGGCGAGTTGGGGTCATCGGCGGCGGGCTCTCAGTCGGGCTCACGTCCGGGAACAGCAGGCCAGCAGTCAGGCAATG
GCAGCGGCACTGCAGCGACGGGAGTCGGCAGCAGCAGTATCCTCAGCAACCGGGTGGCCCGTATCGACGGCGAGCATGGC
ATCTCCAAGATTGAGCGCGACGGCAAGCTGGAATGCTCGTACTGCTGGCACATCCGACGCGATACGTTTGACATTCCCAT
GATGATTGTGATGAATGTGAGTTTTTCTCCGTCTCTCCTTTTGCCTGCTCTATCCTATGCTCTATCTTACTGACCTCTCA
GTTTCTTCCGTGTTACTATCCAAACCAGGAGCCGCATCAGCTGGCCGTTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62