GenePrediction:GLEAN_1839 Details

Name: GLEAN_1839
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1441534..1444186 (+ strand)
Length: 2653
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1441534..1441674 (+ strand)
Length: 141
Type: CDS
Source: GLEAN
Position: GCSC_144:1441808..1442139 (+ strand)
Length: 332
Type: CDS
Source: GLEAN
Position: GCSC_144:1442224..1444186 (+ strand)
Length: 1963
>GLEAN_1839 class=GenePrediction position=GCSC_144:1441534..1444186 (+ strand)
ATGGCTCTCTCAGAACGCCGAATCCTCATCCTGTATGGCTCAGAAACGGGCAACGCTCAGGAGAAGGCAGGAGAGATCGA
TAGGCTATGTCAAAGGCTACGATTCAGCACGGAGTTGGAAGAGATGGATGGTATCAAGTTGGTATGTCCAATCTTATACC
CGTTTACTCTTGCTTGCTTGCAGCTATACAACATACTCTTTCCTTTTTCTATCAGTACACAGAGCCGAATCCAACTGCTT
TGTTGAGGACACTACAATGTGCTGACACTGACAGAATACTTTGCTCTCGGACTTCAGCCTGGTCATATTCGTCATATCCA
CGACTGGACAGGGACAGTTTCCTAAAAATGCTTTGGGTTTTTGGAAGAGTCTGCGCAGAGCTAAACTTCCACCAAACTGT
CTCTCGTCTGTTCGGTTCACCACCTTTGGACTTGGCGACAGCTCTTATCAAAAGTGTGCTACCCGAACCATTCTTGTTTT
CCTGTCGATTTTCTCACGCCTGTATAGATACAATTGGGCATCAAGGTTGCTTCGCAGTCGCCTCCTTCATCTAGGAGCCC
AGGAGGTCTTTGATCGCGGTGAAGCTGATGAGAGACACGAAGACGGGTAAGTAGTCTTTCACCTCCTGAACCTGTGCATG
ATATTTGCTTGAGCCCCAGCTGACAAACCTGACCCTCAAAGAGTTGACAGCATTTATCAACCGTGGGTTCAGAATCTGAG
AGAATATCTTCTGTCCAGCTTTCCACTACCCGCTTCTATTGACCTCATCCCAGCCGACCATCCTCTTCCACCTCGGTACT
CTCTGAGGATCATGCCCAAGATGGAATTAGATACACCAGATGAGATGCCTATTGATAGCGCATCCGCCGCGCAGTCTCCT
GACCTTGCCACTTCTATATTCATCGCCAACAGAGAGAGGAACGCAGCTTTGTCTCATGTAGAAAGGCCACGATCTAGGCA
TGAACAAGACGACGAAGACTGGGATCGCATCAAGAGAAATTTAGCAGTGAGAGCGCGGCAGGACACAAAGACCGCTCCCG
TCTGGCTGGGTAGCTCGCCCGTTGATATCCTCGATAAAGCCAACATCCTGAAGGATGCTCCAGAAAAGTATCTCCTTCAT
AAGTCACCGGCAACTCCTGCACCAATAGAGTTCCCAAAAGCCGTGATTTCCAACATTCCCGGTACTTCGTTGGCCAGAGT
CATCAGCAACACGCGAGTGACTCCTCTAGGTCATTGGCAGGATGTTCGCCTGCTTACGTTGGAAGTCGCCATTCCGATAA
TGGACAACCTCAAATACTCCGCTCACCCAGGGGATGTGATTGTGCTGTACCCCCAGAACTATCCAAAAGATGTGCAAAAC
CTCATTGACATGATGGAATGGGGGGCAGCTGCGGATGCGAAGATGGAATTTGTCAACGGATACATGCCCAAGGGATTCCG
TCTACAAGAGGGGGCAACTCTGAGAGATATTCTCACGAACAACATTGATTTCACCGCAGTGCCAACACGAATGTTTCTCG
AAAAGCTGGCGGATTTTGCAACGAACGGTGACCAAAAGGAAAAGCTGCTGGAGCTTGTCATGCCTCAGTTTTCAAACGAG
TTCTATGACTTCACATCACGACCTCGTCGCACAATACTAGAGGTGCTTGCCGAATTCTACTCGGCAAAGATACCTGTAAC
TCACGTACCCGACATGTTTCCGATAATTCGCGGACGCGAGTACAGCATCGCCAACGGTGGTTGTTACTGGAATAAAGTGA
CTATTGAATCAAAAGAAGCGAAGTCAAAGAGCAGCCAGCACCCAGAACGAGGACCGAAGCAAGCCTCGCTGCCTCGTGGA
GAAAGAAGCAGCACCCAGAGCGAGCCCACGGCGTATAACCCACAGGTGACCGGACTTGTCACATATCGATTTGAGCTTTT
GATTGCTCTAGTTGAGTACAAGACGATTATCCGAAAGCCACGCCAAGGCCTTTGCTCGCACTACATCAAGCATCTACCTG
TTGGGACACCGCTCAGAGTTGGCATAAAAAATCAGACACCGCCGCCCAACGGGCACCTTGCTGCGCGGCGCCCTCTAATT
GCAATCGCAGCAGGGACGGGAATTGCACCGATCCGAAGTCTCATTCACGATCGTAGCCTTCACGACGATGTTGCCGAAAC
GTTGCTATTTTTTGGATGTCGAAATGAGGCTGCCGACTTCTACTTCAGTGAGGAATGGGATAAGACAAAAGCCCTCACTG
TTATTCCTGCATTCTCTCGGGACCCAAAGACGGATAGCAAGGCCGCCTTGTTCCAGCAGCAAAAGATGGATGATCTGGTC
GGAAACACATCCGACCACTATCTGCGAATGCAAGCTGGCCTTCCGCCACTGGACGCGCTGTCGACTAGCAAATTGTCGTA
CGCCTATGACGAAGGAAAGAATTACGTCCAACAACTGATCAGACGTCACTCGGAGAAGGTATGCAAATTACTTGCTCAGG
ACGCCATTATCTGCCTCTGTGGAAACAGTGGCCGTATGCCTAAATCGGTGCGGGAGGCTCTACGGGACGCAGCTATTATG
GGCGGCTTTTGCAAAAATGAAGCAGAGGTCAAACAGAAAATTTTCAGTGACAAAGCTGGAACAAGCATAACCTTTTGGGA
AGAAACCTGGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62