GenePrediction:GLEAN_183 Details

Name: GLEAN_183
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:45332..51936 (+ strand)
Length: 6605
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:45332..45375 (+ strand)
Length: 44
Type: CDS
Source: GLEAN
Position: GCSC_167:45440..45619 (+ strand)
Length: 180
Type: CDS
Source: GLEAN
Position: GCSC_167:45684..47761 (+ strand)
Length: 2078
Type: CDS
Source: GLEAN
Position: GCSC_167:48839..50439 (+ strand)
Length: 1601
Type: CDS
Source: GLEAN
Position: GCSC_167:50626..51936 (+ strand)
Length: 1311
>GLEAN_183 class=GenePrediction position=GCSC_167:45332..51936 (+ strand)
ATGGCACCCCAAGATACTTTCATCGAGGATGAGGACGACACATGGTGCGTTTAGCTGTTCTAATTTTTCTTCTTGCCGTT
TGGCAGCTAACACTGGCTACCGATCCAGTCCCCTGTGCATCGAAGAATTCGACCTCTCAGATCGAAATTTTCGGCCATGT
CCGTGTGGATACCAGATCTGCCAGTTCTGCTTTAACAACATCAAGCAGAACATGAATAGTCTTTGTCCGGCATGTCGACG
CCCATACGATGAGAAGTCCATACAATGGAAGGTCGTCACGTCTGAAGAGTATGTTTTAGAAGCAAGCTTCTGACCCGCCT
GCAAAAGAAAGAAAACTGACAAATTCAACCAGAATCGCCGAGTTTCGTTCCAACATCCAAAAGAACCAAAAGAAAAGAGC
TGCCGAGCAGCGGCAGAAAGAGGTTCAGAAACGCGAGGCTGAGAAAGAGAATCGAAAAAACCTTGTTGGTGTGCGGGTTG
TTCAGAAGAATCTTGTCTATGTGACGGGATTGAATCCGACCGTACGCGAGGACGAACTGTTGAAGACGTTGCGGAAACAG
GAATTCTTCGGTCAATATGGCAACATACAAAAGATATCCATCAGCAACCGCAAGAGCCCTGACGGTTCTCCCTCTCTTGG
AATCTACGTCACCTTTGAAAAGAAAGACGAGGCGCAGCGGTGCATTCAGGCTGTCAACGGCTCCGTGAACGGAGAGCGGA
CGCTGAAGGCACAGCTAGGTACCACGAAGTACTGCTCTGCTTGGCTTCGGCACGAACAGTGCACGAATCGGCAATGCATG
TTCTTGCACGAGTTGGGAGACGAAGAAGACAGCTACACCCGGCAGGACCTCTCATCAATGAACAGTATCAACACCCAGCG
TCCTCTGAACTCGGCTTCACGATCGGCGTCGAGACAGCAGAGTCATCCAGTTGCGGTTCAGGTCGCCACTGTTGCTGCAG
CACAGCCCATGGCACGCACCGTAAGCAAAGATGGCTCAGAGAACGAGGATGCGTCGGCGCTGCCCTCGTCTGCAAATTGG
GCGAGAAATACCCAGGCTCGAAGCAGGCGCGGCAGCTACGCAACAAGCGGCGCTGCTACTAGCCCGGCCGTCTCCATGTC
ACTACCGGTAACTGCCGAATCCGTCCAGGAATCTATCGAGTCTCCGATTCAAGAGGAAGCTGTTCTTGCGCCCGGAACTA
ACCCTGCTCAAGTGAAAGTGAAAGCAACCACCGACACGACTCTCTCCAAGGCTCAAGATGCAAAAACCAAGAAAGAAAAT
GACGCATTGACCAAGCTCTTCTTGAGCCTTGTACAGGCGATGGAGAAGTGCAGCCTTCCGTCGACTTTCCTGCTCGATGG
AATCACACTGGACGCGCACCCCCCTCTGTTTGACCCACGTGGAGGCGAAAAGCGTCGGGCTCTACGGGATGACGAGAGCC
GTCTCGACGTGGAGCAAGAGGAGCAGCCGGCCGAAGCCCGAGAGCCGCTTGAAGACGAACCGGAGAGCAGTGGCAGCTTA
GCATTGGGCGGCGAGCCTGAGGACCGCGAGCAACGCCGTGTTGAGCACACCTTTGACCAGCGACGTGGCGGACCGCCACC
ACCGCTTCAGCGGGCCACTACTGACAGTCTGTTTGGATCGTTTGGAACAAACTACATCACGAACGCAAACCCGGGAACTA
TTGGTAACCGTACCATGACTCCTCAGCAGCAGCCTCTCTACCAGCGCACGCCAAACAGCTTTGCGGACCATCCTCCTCCA
GGCATTGCCCCAGCGCAGTCACTGTTTCAAGGCCAGGCACACAGCCGTCAGCAGTCGCGATTTGGATTCGGAAATGAGGG
CGCGGCTGGTAGTGCTGCAACGATCAAGCTGGCGGCGAACCCGCGTCTCATGGCACAGCAATCGTCGATGATGCCGCAGT
CGCTTCATGCACAGAACACGCCGTACTATGCGGCTTCCATGCCGGGGCCTCCCCCCGGGCTGAAGTCGACGGGTACGCCT
CCGGCAATGTTCGGGCACGGGTTCGGTGCTTCGGGATTCGGTGGCAACCCAAAGGACGCGCGGGATTCGGGACAGTTACT
GCAGGAGATTATTCGAAACAGAGGCAGCGCCAGCAGCCAGGCGCATGAGGCAGGCAAGCGTGAGTACATGTTCCCCTCTT
TCCTTAGCCAGTACCCATCGTCCGGCTCTTCATCCCCCGTTCCTGCACCCGGCTTCTCGGCGTCGCTCTACGGTACCCCG
CCTGGAGCATTCCAAGACATCGGGTCAAAGCAGAAGAAGAAGGGGAAGAAGCACAGACATGCTAACACTTCCTCCTCTGG
GGGGAGTGGCTTAGTGGATCTTGCGGACCCGAGTATCCTGCAGGCAAGACTGCCTCACCAGCAGAGCAACGCCGGAGTCG
GTCAGGGACTCTTCGGGGGTCAGGCCCAAGGTGGGTACAACCCGAGCATGATGTACAATGCTGGCTACCCCCGATGGTGA
GAGGGCGAGGGTGCGCGCGAGAGAGAGCGTGAGCGAGAGCGAGATGGAGAGAGGAGCACCGAGAGACAGGCCACAACTCT
GGTCTTTCGTTCCCTTTTGAAGATAAAATGCCAGCGACCCCCTTCATATTACATTCACATCACATACCCGCACCCTATCC
CTGTGCTGTCTCTTTTTCCATTTTGTCTTTAGTTTTTTCGTCTTTTTCGTCTATTCATCTTGGTCTTGTATCCGCAGATC
GGCGTTGGGATGGATTTCATCGAGGTCACGTTCGGGCTGTTGTCTGCTTTTCAACGCCTGATGCCTCGCATGGGGTATAG
CATTTTGATTTTGCATTTGGAGCTGAATACTGCATGACGAATTGGTGGCGGGAACGGAGTGCATCCCAGACCGATTGCAG
TGGGAAATCTTATGACGGGATCTCTCGAGAGAAGAGGCCACGATTTTATGACAGTGCTTCTCGGCATCGACCCGTCTACT
TTTCAACGCTCCAAAGTTTTTGGTCCGGATTCCGGAAGAGTCGTCATGCCAGGCAAGCCATTACCGTCTTTCTCTCGAGG
GATTTGCAATGTATGTTAACACGGGCCTAGTTTTATTATCTTTTTTTTTCTCAGTGTCAAGAGGGTGCGGGAATCAGACT
GGTCGCGCTGTTCATGGTCACCTTAATACCATAAAGAGACTTTTGTGCCCTCACAATTTTGTGCCACACTGTAACTTGAC
CACGTCGACATGTCTGTGCCTCTAGAGGAAGGCAATGACAGCTGCGTTGCCATAGATTTCTGTTCCCGCGCCCGGATGTC
GTGTATATATATTGCAATCTGCTTTGCGGCTTCGAGGGGTTTGGGCTGGTGTTCTGTTGGCCTGTCTCCTCCGCAGTCTC
GATACCCTGCGTTCTCGTCTCTCGTCTCTCGTCTCTCGTTCTCGTTCTCGTCTCGCGTTTCGCGTCATTCCTGCACCTCT
TTGCCATCATACCCTCCTGCTTTCTGAGTTGTATCTTGTGAAAAGGAGACTGACATTGGCATTGCAGACGACGACTTGTC
GGGTTTCCACGAAGCAGTCTCAATTGTGGACGCATTGGTGTCTGACGAGCAGAGCTTGCCGAGCTTGCCAAACTTTATAT
CTGGCGCTCTGGACTCGCCTCTACGGACAGGCACGCCTTTGTTTCCACCTGGCTTCGGCCATGTGCACGGATTTCCGACG
CCGACACCACCGCCTGGCCTTGGGCGGCCGATGACGCCGGCTTCGGTTGGCACGGCCGCCAGCCAGACGGTGCTGCGGCC
GGCTGTGCCGCTTATTCCGATCGATTCGCCACTGGCGAAGAAGGCGGCACGTGTTGCCAGCGGAGGCATCGTCACAAGCG
GCGAGGCAAAGAAGACGGGAGGAAAGGCGGTAGAGAGTCCACTGGTCAGACATGCCACACCGCTGGCAAGGACTGCGTCT
CCGGTGCCAGTTAAGAAGGCGGTGCTACTGCAAGAGGAAGACTTCCCTGCTCTCGATGTGCCAGCAAAGGCAGCAACATC
GACATCGACGCACACGGTTCCAGCGGCGACGCCACGCAAGACGTCTAACATTGTCAAGACGGCGGCAGCAGCTGCAGGGA
CGAAAGCAGGACCAGCCGAGACACCACAGATGGCGACAAAGACAGCAGCCGCCGTGGCCTTGGGCGCGGGTTCGGTGGTG
CCTTCTCGGGTGGCGACGCCTGTCAATGAGAGCAAGAAGGACAGGGCAGACAAGAAAGCGGCACTGGGAGTGCTCAACAT
CACGGCAGCGGTCAAAACGGTGCAGCCGAAGGCGACGACGAGTGTTGGAGTTGCAACGGCTGCTGCCGGGACGACGGAGA
GCAGTCCTTCGGCAGAGAGCGTGATGACGGCGGATGCATTCCCATCGCTGCCGACACCGACAGCATCGGTGAGTACGGCC
TCGGCCTGGTCGCCGGTGGTGCGGGCAACACCCAAGACGCTGCGGGTGGTGCAGTCGGGGGCATCTGGCAAGACGACGGC
CGAGGCGTTGGCGGCGGTGATGTCGCGGTCGTCAGCGGTGCAGGCGTTGAGCCACGGCAACAACAGCAACCGACCGGGTA
CGCCGGCAAGCGAGATCATCTCGGACAACGCGTCACTTTTGTCAGCATCGGTGCCAGCATCACGGGCGGGCTCACCCCCG
CCGTCTCGAATCGGGTCGGCGGCTGTACGGACGACGACAAAGAGCCAGCAGCGGAAACAACGCAAGCAGGCGACGAAGAA
GGAGGCGGCGACGATTGCGAGCCAGCCGGTGCCAGAACAGCCGGAAGAGGAGGAGATTGCGCCGATTATGGGCCGCAAGA
AGAAACAGAAGAAGGAGAAGCCGAGCAAGAGCGTGCCGGTGGCCTCGACGACGTCTACAGCACAGCCAAAGGACGAAAAG
ACGGAAAAGGCAAAAGAGGAGGAGCAGCAGAAGCAGCAGCAGGGCGAAGAAGCTGCGGCCAAGGAGGTCGCCAAGGCAAA
GACATCTGCAAAGCAGAAAGACGACAGCAAAGACAAGACAGTCGCGACACCCAAAGAGAAGTCTGCAGTCCAAAAGGGCA
GGACTGCCAAGGGTAGCAGTAGCACGGCGACGACTGTGGTGGCCTCTGGTGTGTCGAAGACGGCAGCGGTGTCTACGGCG
ACGACTACAGTTTCGGCTGCTGCGCCCACGACTACACCGATATCCACAAGCACAGCCACAGCTGCGACTACGACTACAGC
TGTGTGCACGGCTACAGCTTCAGCTGCATCGGCAATTGCACCGGCAACTGCAGCTGCGAACGGCATGACGACGGCGAAAC
CGCGGACGCGGGAGGAAGAGATGCTGGAGGCGGCGCTGGACGAGGCGAGCCGGATTGCAGGCACGGAGCGAATTCTGGCG
AACATGGGGCCGGAGATCGAAGTCGAGGGCAGGACGCCGTTTGACGTGGTCCGAGACATGATTCGACACGGGATGGTGAC
GCACGAGCGGGACATTTCGGTGTTCTGGCGACAGGATCAGCTGACGGCGCAAGGCATGACGGCAGCGGCAGGACGGCGCG
AGAAGACGATTATTGGCGACGCAATGCTGCAGCCGGACGTGATTTTCAGCGACGAAGACCGGGCGACGCTGCTGGCGGAC
AATGTGGTGCGCAAGGAGATCGACGGGGTGCGGCTGATGGCGACACCAAACGGTGACTGCGTGCGCAACTTGACGGAGGA
GGAGGAGAACCGATATTTGGACCTGCAGCGACGGGTATTAAAGATGGCCGCGACACCGATGGCGTATCGCCATCCACGAT
ACGAGACGACGGGGGGGTTTGCATTGATTAGTAAGCGGGCTGTACCGTGTGGAATGCCGGGATATTTTCCGGCGGCAGGT
GGTATCGGGAGCAAGGCAGCTGTGGCAGCAACTGGGGCATTGACTGGGACAGCGAACATGGCAGCGGCTGCCGGCCAGAC
CGGCCAGACCGGCCAGATGGATCCAGTAGCCAAGATCCAGCGCGAGGAGGCAGTGTACTGGATCAACCAGTACGTGCTGC
CACGACTCAACGTGCTGCCCCAGAGCGAGGCGGAATCGTGGAAGTCGATGCTGGCCGACACGGGAATGCCACAGTCTGTC
GGCGCAGCGACAGTGGCGCCCTGGATCTATCACACGCCCGACATTCGGAACATGTTTGACCATGCCTGCTGTGAGCACGA
CCACGGCCACAGACACGGCCATGTGCAGCATCATCATCACCATCACCATGATCACGATCACGTTCACGATCACGTTCACG
ATCACGTTCACGATCACGATCACGATCATGGTCACGACCACGACCACCATGACCATCATGACCACCACGAGGACGACGAC
TATGACGAGTACGAGGAGGACGAGGACGAAGATGAGGATGAGGATGAGCTCGAGGACGAAGACGAGCTGGAACATGCGGT
GCGGCCGATGAGCGTGGAGGATGCCGAGGCGTCGCTGATCCAGGCACGACGGGACGCGGCCACGCTGGGGCGCACGCTGG
GAATGCTGATGAAGAAGAATCGGCGGGTGCTGATGATGCCGCCGTATTACGAGCAGCAGACGCGGGCTGCAGCGGGTGGA
GGTGGAGGTGGTAGTGGAGCAGCCATGGCAGCGGCAGTGTATTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62