GenePrediction:GLEAN_1840 Details

Name: GLEAN_1840
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1455909..1457076 (+ strand)
Length: 1168
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1455909..1456075 (+ strand)
Length: 167
Type: CDS
Source: GLEAN
Position: GCSC_144:1456154..1456762 (+ strand)
Length: 609
Type: CDS
Source: GLEAN
Position: GCSC_144:1456824..1457076 (+ strand)
Length: 253
>GLEAN_1840 class=GenePrediction position=GCSC_144:1455909..1457076 (+ strand)
ATGAGTTCACCAGCACAGGGCGGCCCGTCGGCCCCCAAGGAGAAGAAGGGCGTTAGCAGTCGAGTGTTGACGAGAATGAA
GACGATGATCAAGAAGGCAGAGAAGCGTATTTCGCTGTCGGGACCCAGCAAGCCTGGTCCGTCGTCCCCTGCAGCTGCAG
AGCCACCGTACGTATCTGTCTCACGAAGTTCGCTCCCATGACCCCTTTTCGGGCTATTACCTGTCGTACCGGCTAACTGT
TGTAGTGCTGGTGGTGCTCCTGTTACTGCTGCCGTCATCCCTGCGGCGGCCACAGTCCCAGCCAAGAAGAAGGCCGAGGC
AGCTGGTCTGGAACCGACAAAAGTGTCGCGAATGAAGCTCCACGAGGAGCGTGCTCGGAAGCTAGGTGAGCGCTTCGGCC
TGGAGATACAGCTAAGCGAGTGGCATTCGACTGAGGGCGAGGCTCTGCGTGTCAACAAGCCGATCCGCATGCGCGTCCAC
CGCGTCTGCCACGAGTGCAACACGGAATTCGGTAGTTCGAAGGAGTGCACGAACTGCAAGCATGCCCGGTGCAAGAAGTG
TCCTCGGTACCCGCCGAAGCGGACGGAGGCCGAGAAGGTGGCCAGCCGCGAGCGGCGCGCGCAGATTGTCAAGGAGCGGA
AGGAGAATGCTCCCATCGTTCCGGACTGGGACCATACTCGCAAGCCGATCACTCTTACGATTCCGTCCAAGAATGGCGGC
CGAGACCTGGTCTACAAGAAGCCTCGCCAGCGTGTTCGCCGGAACTGCTGCCAGTGCAACAAGATGTTCCTCGCAGGAAA
CAAGAAGTGCCCTGGCTGCGAACACGCCCGATGCACCGACTGCCCTCGGGACCCGTACGTTCTCACTGCCTTGCGGTCCG
TCCTGTTTGTACGAGTGCTGACTGACATGAAACAGGGCCAAGAAAAACAAATACCCGTATGGCTACCCAGGCGACGAGTT
TGGTGCCAAGTCTATACCTCGCTACAGATGCCAGGTGTGCAAGACCAAATTCCCGGCCGAAACAGACAATGGATCGGAAT
GCGCAAAGTGCTCGCATCCTAAATGTGCAGACTGCCCTCGTCTGCTGCCGCAGCGTGTGGAGCCTGAGCCGGATCCGGAG
ATTTTGAGGTCGATTGAGATTCGCATGGCCAAGATGAAGGTGGGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62