GenePrediction:GLEAN_1841 Details

Name: GLEAN_1841
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1466801..1468161 (+ strand)
Length: 1361
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1466801..1466938 (+ strand)
Length: 138
Type: CDS
Source: GLEAN
Position: GCSC_144:1467010..1468161 (+ strand)
Length: 1152
>GLEAN_1841 class=GenePrediction position=GCSC_144:1466801..1468161 (+ strand)
ATGATTCGCCAAATACGCCCGTCTCTGGTTTGTCGTTGCCGGACAACGACAACACGCCAGTTCTCTTCCCAGTCGCCGCT
GTGGCGCGAAGTTCGAGAAGCATACATCTTGAGCGCTTCGCGGACACCAACTGCAAAGGTACATCAGCTCTATGTCTTTT
GGCAGAACGTGTTTATTCCCTCCGCCATGCTCGTACTGACCTCTGTTAGTTCAACGGCTCGTTTCTCAACGTTTCGGCCC
CACAACTCGGTGCTGTTGCCATCAAGTCGGCGATCGAGAAGTCGGGCGTGCCCATCTCCAAGATTACCGATGTCTACATG
GGCAACGTATTGCAAGCCTCCGTGGGCCAGGCACCCGCACGACAGGCAGCCATACTCGCCGGCCTTCCAACATCCGTCGA
AGCTATCACGGTGAACAAGGTGTGCGCCTCGGGCCTGAAGGCAGTGTCGCTAGCAGCACAGAATATCCAGCTGGGCCTGG
CCGATGCCCAGGTGGCCGGTGGCATGGAGAATATGTCTCGCGTGCCGTATTACGTGCCACGGGCGAGCGGCTTACCGGCC
TTTGGCCACGTGCAGATGACAGACGGCCTACTCAAGGACGGGCTGACGGACGTCTATGGCGGCTTTCATATGGGCATCTG
CGCAGAGAAGACGGCGAAGAACCACAGCATCACGCGTGAAGATCAGGACAGCTACGCGATCCAGTCATACGAGCGCGCGC
AGGCGGCATGGAAGGCTGGTGCATTTGTCGAGGAAATTGCGCCGGTGACAATCGTGGACAGGAAGAAGAAGGAGACCATC
CTCGACACAGACGAAGGTTTCCTGGACATCAACGTGGACAAGCTGCGGTCGCTGAAACCGGCCTTTATCCGCGACGGCAC
CGGCACGGTCACGGCAGCCACCTCGTCGACGCTCAACGACGGTGCCTCTGCAATCGTTCTCGGCAGCGCCGACGTGGCGC
GCGAATATGCGGCCGGCGGTCGGTCCCGCGTTTTGGCCCGCATCTGTGCCTCAGCCGACGCGGCCGTTGATCCGATCGAC
TTCCCCATTGCGCCGTCCAAGGCCGTTCCCCTCGCGCTGGAGCGGGCCGGCATCACGAAGGACCAGGTGGCCGTCTGGGA
ATTCAACGAGGCGTTTGCAGCGGTGATCAAGGCAAACGAGAAGATCCTGGGTCTGGAAAACGCCCGCGTGAATCTGCTGG
GCGGTGCGATCTCCTTGGGGCACGCGCTAGGCAGCTCGGGTTCGCGCATATTGGTCACACTGCTGCATCAGCTCAAGCCA
GGCGAGTACGGCGTGGCAGCCATCTGCAACGGCGGCGGGGCGGCAACGGCCATGGTGGTCCAGCGCATAGAGTCTGTATA
G

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62