GenePrediction:GLEAN_1842 Details

Name: GLEAN_1842
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1469246..1471149 (+ strand)
Length: 1904
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1469246..1469509 (+ strand)
Length: 264
Type: CDS
Source: GLEAN
Position: GCSC_144:1469577..1469734 (+ strand)
Length: 158
Type: CDS
Source: GLEAN
Position: GCSC_144:1469821..1470352 (+ strand)
Length: 532
Type: CDS
Source: GLEAN
Position: GCSC_144:1470421..1471149 (+ strand)
Length: 729
>GLEAN_1842 class=GenePrediction position=GCSC_144:1469246..1471149 (+ strand)
ATGGCCGACCCCTTCGCCCCCCGCTCGATGAAGCGGAAAAACGTCAAGGGCCTCGCCCTGACGCCGGCCGCCCCCAAGCC
GCCTCCGACGGCAGAGAATGGCGGCCGTGGCGACGACCAGTCTGGCCAGCTTGAGATCGGCATCGAGTACAACCTGGACC
TGCGTCCCAGCGACCTCGAGTTCATCAAAGAGCTCGGCTCCGGCAATGGCGGTACCGTCAGCAAAGTCCGGCACATTGTC
ACCAACACGACCATGGCTCGCAAGGTGCGTCGGCTTCTCTCTGCAGTGTCTGCTGTTGGCTTGTTGCTGACCAGGCCGTC
CGTTCCCTTAGGTTATCCATGTCGAGGCCAAGCGAGAGATGCGGAAGCGGATTGTACGAGAGCTACAGATCATGCGTGGC
TGCCACTCCGAGTATATCGTGACGTTTTATGGCTCCTTTCTCAACGACAACAATGACGTGATTATGTGCATGGAATACAT
GGATGTTGGGTACGTGATGGGGAAAGGCAGGAGCAGAGAGACAGTCGGTGCAAGTTGTGACCGTTTGTCTGCTAACATGC
ATGCACCTCGCCCAGCGCTCTTGACCGCGTCTCCCGCGTTTTCGGCCCCATACGTGTCGACGTTCTCGGCAAGATCGCCG
AGGCCACGCTCGGCGGCCTGACCTATCTCTACGCCAAGCACCACATCATGCACCGCGATATCAAGCCGTCCAACATCCTC
GTCAACTCTCGGGGCTCCATCAAGCTGTGTGACTTTGGCGTCTCTGGCGAGCTGATCAACTCCATCGCCGACACCTTTGT
GGGCACGTCTACCTATATGGCTCCGGAGCGTATCCAGGGCGAGCGCTACACAGTCAAGTCGGATGTGTGGAGTTTTGGCC
TGTCCATAATGGAACTTGCTATTGGTAAGTTCCCCTTTGCTGCTAGCGAGCAGCTCTCGGACGCCGAGAGTGCTCCAGCT
GGTATCCTCGACCTTCTGCAGCAGATCGTCCACGAACCGGCGCCGCGTCTACCCAAGAGCGACGCTTTTCCCTCTATTCT
CGAAGACATGATCCAGAAGTGTCTCTTCAAGAACCCGGACGAGAGGCCAACGCCACAAGACCTCTTTGTAAGACCCCTCT
CTCTCCTCCACCAAGAGCTGGCAGCTGACAAATCCTCTTTTCGGTTGGTTTACAGGACCGCGACCCATTTGTACAAGCAG
CGAAGAGAACACCGGTCGACCTGCAAGACTGGGCAGTGGGCTTGATGGAGAGGGACAACCGGAAGTCCCACCTCGCGCCG
CAGCTGTCGCCGGCCACACAAGAGCTTCTCCGCTCCACCGACACGTCGACGGCCAACAACGGCGATGCCCGTACGACGCA
GACACAGACACCGACTTCAGGTGAGATCCCCATTGTGGGCGATATTCTGTCACCTCGTGACCAACATAGTACCAGCCTTC
CGGGCCGGACCCCGACGCGGGGCGGGACTGGCAACGGGATCGAGAGCGGGGCCATCACCAGCGGTGGCGCCAGTCGGGAT
GTCCCCAGCAATAGCATCAGCTTCGGCTCCGGGTACAACAGCCTTGGCCGACCAAATGGACAGGCTGTACATTCAGGCCT
GGGATCGCGAGTAGTGGCCGTGGAACCTCCGAGTGTTTCACGTGCCCCGCCACCAATCCCGGTTGGGCTGCGCAACGGCA
TGTCTAGTGCATCATCCAGTGCCGGCCACAGTACTTTCAGCCTTACTGTTCGCCCGGCGCCCAAGGTTGGCGGACCGCCA
CCCCTGCCACCGAAAAAGGAGACATCAGACGAGCATCGGCGGCGTCAGCTGCTGTTGCAGCAACAGCAGCAACAGCAGCA
GCAACAAATCTTGTATGCGTCTTCAAAAATGGAACCATATCCCAATGGATATCCAAACAAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62