GenePrediction:GLEAN_1843 Details

Name: GLEAN_1843
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1473143..1476927 (+ strand)
Length: 3785
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1473143..1473235 (+ strand)
Length: 93
Type: CDS
Source: GLEAN
Position: GCSC_144:1473352..1475527 (+ strand)
Length: 2176
Type: CDS
Source: GLEAN
Position: GCSC_144:1475582..1476927 (+ strand)
Length: 1346
>GLEAN_1843 class=GenePrediction position=GCSC_144:1473143..1476927 (+ strand)
ATGAGCCCATCGGTGAATGGGGGGACATCGACGGCCGGGGCTGGCGGCAGCACGGCACAGCAGTGGCCGCCTCGCCGGCC
GTCAAAGCGAAGTGTACGAATGATCCTCCCGTCTTTGCTCTTAGCGTTCCCTGTTTCTGCTGCATGTGCCGAATGCGTGT
GACACAGCTTGGGCACACATGACTTGATCTGGCTGGCTAACGCGGGCAGAAGCTGCGCAACTCGACCTTTATCATCCCGT
CGACGGGCGAGCGTTCGCGGCGCCAGTTCACTCTTCGCAATGGCAGCCCCTCTGTGCTCAACGGCTACAGGACACGACGG
AGAGACTACGACGAGAACGACGACGGCGACGAAAACGAAGACGACCCATCCTCCTTCTTCACGGCGTCAGGATTCAGCAT
GCGCATGGAGGCGATCGGCCGGGCCTCCTCGGACGGGCTGGGGCGATTTCGGGCGTGGATGGAGTCGCCTAATGGGCGGG
GAGTGATCAAGTGCACGGTGGCATACACGATTGCGAGTCTCTGGACGTTTTGGGCGCCGCTGTCAGATCTGCTGGGCAAA
CCGGACGGCAAGCACCTGGTGGCGACAATCACGGTGTATTTCCACCCAGCCCGCAGCGCCGGGTCGATGATCGAGGCCGG
GGCGATCAGCGTGGTGGCGGTTGCATACGCGGAGATCATCTCGGTGCTGTCGATGGCGGCATCGGTACTGTTCGGGTCGG
TGTTGGGATGGGTGACGTTTGCGTACGCGGTGGTGCTGGTGTTCTTCATCGGGTTTGCCTTTGGATTCATCGGCTGGGTC
AAACAGCGGCTGAACAACCCATCGGTCAACGTGGGCTGCACGCTGGCGTCGCTGGCGATCATCACTGTGGTGACAAAGGA
GAATGCGACGTACAGCAGCGTGTTCTCGAACACGAAGATCGTGCAGGTGCTCAAGATCCTCGTCTTTGGCATCTGCACGA
CGTCGTCGGTCAGCCTGCTTCTGTGGCGCGTGTCAGCACGGGCACTGCTGCGCGAGTCGCTCACGCGGGCGTCCACATCG
CTGGGCGACATGCTGGCGATGATCACACACGGCTTCCTCAGCGGGGCCGAGGACGAGCTGACGATGTCGGCCGAGTACGG
GGCGGTGAGCGCCAGCTGGACGGCGGCCCACGCGCAGATGACCAAGAACCTGAGGGAGGCCAAGTATGAGCACTACGCGG
TCGGCCACGCGAGCCTGTACCAGCTGGAGAAGTCGGTGTACAAGTCGATGGAGACGCTGGCGCAGTCGATCGGCGGGCTG
CGCAGCGCTGCCAACACGCAGTTTGAGCTGCTGCGCGAGGCCATGGCGGCTGCAGACGCAGAGATGGACGGGTTTATGCC
ATCTTCGCCAGCTGCCAGCCGGCCAGGTCTCCTGCGGACAAGTTCGAACTTTCAGCGTGGCAGTGGTGCGGCAGCGCCGC
TGGCAGCCATTGACGAGGCGTCGGACGAGAGCACAGACGAGAGCAGCATGCGTGGTGGCCGGCGGGCGACAGGAGAGGAT
GGCGAGGACGAGGATGAGAACGATATTGGTAACACCAAGAACACCATCATCTACAATCTTGACAATATCAACACCATTGT
CGGATCGCCCGGGTCCATCGGCGCAACAACGACGACAGCAGGCGATAGCAACGGTTCACGACGCGGCAGCACGGCGACGC
TGCGGACGTCGACAGAGATATTTGAGCTGTTCATCGGGATGCTGGGCCCGTCGATGAAGTCGCTGGCGTTCACGTTGGCG
GGAGTGCTGCGCGACCCGCCGTTCGGCTCATCGCCCGACTTTGCCATCACGGTCAACGGGCACTACCGGCAGAGCCTGGC
GGACGCGCTGGTGCTGTACAACGGGTCGCGGGCGGCAGCGCTGCAGGAGCTCTACAAGACGATTGAGTTTGGGCGGCCGC
GGTCCGAGAAGATCAAGGCCGACTTTGAGGAGGTGGCAGCGGCCTGCGGCCACTTCAGCTTCAGCCTGCAAGCCTTTGGC
GAGGAGATGACCAAGTACCTCGACGTGCTGGACGACCTGCGTATCGTCAGCACCCACGACCGTCGGAGCTGGCGCTGGCT
GCTCTTCTGGAAGGCACCGCAGCTGCGCTTCCCGTCCGTGTTGCCGTTTGAGAGCCCGGCCGAGCCGGCCTTTGACGAGG
CCGTGGCCTCGGCGACGGCAGCGGGCACGGCCAGCATGCCGAATCCGGTGGGCACCCCAGCAGTGCGGCCCATTCGCAAG
TCTCAGATGCCGCGCGGCATCCCCGACACCATGGTGCAACGACGGGACACGTTCAGCTGGCAGGCGGCACCACAGGCCAA
CACGCTCGTGCGTAGTTTTGCACAGGAGCTGCTGAGACTCCTTCGTGTGCTGATGCGAGATGACAGTAAGTTTGTTTGTC
TCCTTGTTTCTCCTTCTCCTTCTCTTTCTAATAAAACAGTACGGTTTGGAATCAAGGTGGGCATCGGAGCAATGCTGTGG
GCCTGCATGGCCTTTACTCCAGAGACACGCAAGGTGTACATGCACTGGCGAGGCGAATGGGGACTGCTGTCGTTCATGAT
TGTGTGCTCCAACACGGTCGGGGCTTCCAACACGACAGCCATTGCGCGGTTTCTGGCGACGCTGTCGGGGGCAGCAGTGG
CGGTGCTGAACTGGAACATCAGCCAGGGCCACGCGGTGCCGCTGCTGCTTCTCGGCTGGCTGGTGGCTTTTTACAGCTTC
TACGTGATGATCGACCGGGGCAAGACGCCGGTGGGCCGGACGACGCTGCTGGCATACAACGTGATCACACTGTACGCGTA
CCTGCTGTCGCAGCGCGTGGACGACGACGATGACGACGAGGGCGGTGTGCATCCGTTCATCATGGAGATTGCCAAGCATC
GGTTCCTTGCCGTGACGGCCGGCATCCTGTGGGGGCTGATTGTGTGCCGGGTCGTGTGGCCGAATTCGGCGCGGCACCGT
TTCCAGGAGGGCGTGTCGGTGCTGTACCTGCAGATGGGTCTCATCTGGAAGCGTGGACCGCTGGCGATGCTCCTACGAGC
CGACGGTGGAGGAGACAGTCCGGATGGCAGAAACGGCAGCGGCATCGCTCACCCGTCGTATCTGCGGTCGGGCGAACAGG
CGGCGCTGCAGCGGTACGCAGCCCGGCTGGAAACGCTGCGCCAGAGCGCCGGATCCGAGTTCGAGCTGCGCGGGCCCTTT
CCCTTCACGGCGTGCGGCCGCGTCATGGCGGCGACAAATCGCATCCTCGACGGCTTTTACGCCATGAGCTTGCTGACTCA
GCGACGAGCCGCCCGCCTAACTGACGGCGAGCGCGCCCTGCTGCTCTACACGGCACCCGAGCGCGCCATGCTATGTGACC
GCATCTGCCACGTCTTCCAGGTTCTGGCCAGCTCTTTCATGCTCGAGTATCCGCTGGCTGACGCGTTGCCGAGTGTCACT
ATTGTGCGTGACCGGCTGTTGGCCAAGATCTTCCACTTTCGCAAGGAACAGGCGGCCGCAACGGCCGGGACAGCGGGCAC
GGCCGGGACAACGTCGACCTTCACCATGGACCAGCTCATCAGCTTTCCTCCCGCATCGCCGTCGTCGCTGCTGGCCTCGC
CGTTTTCGGACCTGCCGCCACCACCCGGTCCGTCGATTCGCGTCGCGGCCGAGGAACAGGACTACGCGCTGCTCTATGCG
TACGCCCTCATCACCGGCCAGGTCGCCGAAGAGCTCAGGACGATTGCCAAGGAGTTTGAGGGCCTCTTTGGCGTGCTAGA
CGAAGACGCGATGTTGCTGCAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62