GenePrediction:GLEAN_1844 Details

Name: GLEAN_1844
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1481103..1482923 (+ strand)
Length: 1821
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1481103..1481444 (+ strand)
Length: 342
Type: CDS
Source: GLEAN
Position: GCSC_144:1481499..1481523 (+ strand)
Length: 25
Type: CDS
Source: GLEAN
Position: GCSC_144:1481572..1482923 (+ strand)
Length: 1352
>GLEAN_1844 class=GenePrediction position=GCSC_144:1481103..1482923 (+ strand)
ATGTATCAGACCGGCTTCTTCTCGGCCGTGTACCTCTTCCTGATGGTGGCCGGGTCCTGGGCGGCCACGGTGACGTACGA
TTGGGACATCACCTGGGTGTATGCCGCGCCGGATGGCTATGGCCGCCCAGTCATCGGGATCAATGGCGCGTGGCCGTGTC
CCAAGATCGAGGCCGAGGTGGGCGACACCGTTGTAGTGAACGTGAACAACCAGCTGGGCAACCAGACGACCGGCATCCAC
TTTCACGGCATCAGCCAGGCCAAGTCGACCTGGATGGACGGGCCCAGTGCTGTCGACCAGTGTCCGGTGCCGCCTGGTTC
CTCGATCACGTACAGTTTCCTGGTACGTAAATGCGATCCTTTTCCCTGCTAACAGCTGCTAACAAATCGTGCTCAGGCCG
ACGAGCCCGGCACATTCTGGTGTAAGGCCTCCCCGTTCTTCGCGTGACTGCCCTGTGCTGACGGTCCAGACCACTCGCAC
AACCTCGGCCAGTACCCGGACGGACTGCGAGGCCCGATGATCGTTCACGACCCCAACGACCCGTACGCAGGCCAGTACGA
CGAGGAGGTCATCCTGACAGTCTCGGACTGGTACCACACCCAGAGCCTGTATCTGGTGCAGGACATGCTCGTGACGTCCA
ACACGCAGTTCTTGCCGCCCTTCCCCGATAACATCCTCGTCAACGAGGGCCAGGGTGCCAAGATCGACTTTGAGGTCAAC
AAGACGTACCGCTTCCGCATCATCTGCTACTCGGCCTTTGCCTCGGCCATGCTGCACTTTGACTCGCACACGATGCAGGT
GATCATGAACGACGCTTCGTACGTGACCCAGAAGCAGGCCTACCAGCTACGCATCAGCCCGGCCCAGCGCTACGACGTGC
TGATCTCAGGCATCTCACGTGACCACCGCAACTATCCCTTCCTCCTGTCGCTCGACATCAACCGCGACTATGCCGTCGAT
GCGGCCTCGGGCATCGTGTGGCCGCACAACTACACCGGCCAGCTCGTCATGAAGCCCAACGGCACCTTTTCTGACGACGT
CGTCGCCAAGTGGCAGCCCGTCGACGATGCCCACTTCCAGCCCTACGACAGCCTCGCGGCCTATAGTCCGGTCACCACGA
CCATCACGCTCGACTTCAGCTTCTGCGACGACGTCAACGGCTATCCGCGTGCCTGCTTCAACAACAAGACGTACATCGAC
CAGACCGTGCCCACGCTCTACACCGCCGCCACTGTTGGCGATAACAACACGAACCCCCTCGTCTATGGCGCCGTCCAGCC
CTACATTGTCGATGACGGCGAGGTCGTCGAGCTGGTCGTCAACAACCAGGACGCCGCCATCCACCCCTTCCACCTGCACG
GCCACCAGTTCCAAGTGCTCGACCGGCCCTCCAGCAACACCGGCCTCTGGTCCGGCAGCAGTCGCACCTTTCCGGCTACG
CCGCCTCGTCGTGACACCATCGCCGTCAACGGCAACTCCTATGTCGTCATCCGCTTCAAGGTTCAGAACCCCGGCGTCTT
CCTCTTCCACTGCCACATCGAGTGGCATGTCGAGATGGGCCTTACCGTCACCATCATCCAGGAGCCCGACCAGCTCAAGG
GCCTCACCTTCCCCGACGACCACATTGCCAACTGCAAGAAGATGGGCATTCCTTATCAGGGAAATGCTATCGGCAACACC
GTGGACCCCCTGAACACTACCGGCTTCCAGACCGTGCCCTCCACGTCGTATCTTGGGTGCGTTGTCCCCTCTCTTGTTCT
CTCTCCCTGGCCGCTGACCTTTCCCCAGTGCGATGTACGTATCAACAACGTCAACGTCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62