GenePrediction:GLEAN_1845 Details

Name: GLEAN_1845
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1489324..1496080 (+ strand)
Length: 6757
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1489324..1489616 (+ strand)
Length: 293
Type: CDS
Source: GLEAN
Position: GCSC_144:1489675..1489966 (+ strand)
Length: 292
Type: CDS
Source: GLEAN
Position: GCSC_144:1490083..1495983 (+ strand)
Length: 5901
Type: CDS
Source: GLEAN
Position: GCSC_144:1496045..1496080 (+ strand)
Length: 36
>GLEAN_1845 class=GenePrediction position=GCSC_144:1489324..1496080 (+ strand)
ATGGCTAACAGGCTGGCATTCCTTCTCTTTGGGGATCAGTCCCTCGACACGTACGCCTTCCTGTCCGGACTCTGCCGACA
GGACAACACAGGCATCCTTGCCCAGGCTTTCCTGAACCAGGCCACTGAGGCTCTGCGGAAGGAAGTCGAGGGCCTCCACC
GGATCGAGCGTGCGAAGCTCCCGGTGTTCAAGACCATCCAGCAGCTGAACGAGAAGTACCATTCTCAAGATATCAAGCAC
CCCGGCCTGGACGGAGCTTTGCTCTGCATCACACAGCTTGCACACTACATTGAGTAAGAGCCAGTCCTCATGCTGTAAAT
GAACCGTACCGACTGGCTAACTGTCCTTCAGCCATGGCGAGAAGCACTATGAGGATATCATCCGACACGACCAGACCTTC
TTAGCCGGTCTATGCTCGGGCCTCTTTGCGGCTGTGGCCATCGCCTCGACACCGTCGCTGTCCTCGCTTGTGCCCGTGGG
CGTGCAGGCTGTGCTGATGGCATTCCGGACAGGCTCTCACGTGGCCAAGCTTGCCGACCGCCTTAGTCCTGCAACCGGCC
GCTCTGAGAGCTGGACATACATCTTCCCCAGCCAGAAGGAGGAGGAGACCCGGAAGGTTCTTTCCGAGTTTTGCCATGGC
AAGGTTTGTTCCTTCCACTTTGATGCACCGGCACTGCTTATTAATCCCCTCTCGGCAACCCTCAATTCCATTTCCACATT
TCCAAAGCCAAAGCCAAAACTGACAAACTACCAAAACAGTCTCTTCCCCAAGCCAGCCAGATCTACATCAGCGCCGTGTC
AGCAAGCAGCGTGGCGGTCTCTGGGCCGCCGCCGTCTCTGGAGGCATTTATAGCGACGGGCCAGCTGGGCCGGTCGACGT
CGATTCCAGTGTATGGACCGTACCACGCCAGCCACCTGCATGCGGGGGCGGACGTGAAGAAGATTCTCCGGCTCGAAGAC
GCAGCGGTGGTGGATGCGCTGTTCAAGACGAAGCCACGCTCGGCGGTGATGTCTTGCACCACTGGAACGTGGTTCAGCGA
GACATCGACAGCGTCGCTGTTTGAAGCGGCTGTGTACGAGATCCTGAACGAACCGCTGATGTTCTCGCGCGTCGTGGACG
GCTGCCTCGACATAGCCCGCGAATTCACGGGCGTGGAGTGTGTGGTGATTCCGTTTGGGCCGACGCAGAACGCGAGCTCA
CTGGCGAACCTGGTGCGGTCACAGACCGAGCTCAAGGTGTCGGTTGTGCAGCAGCCGGATTTCGGGTCGGCTGGTGTGGC
CGGAGCGCCTGCACCGACGATTGGCAACCATGGGGCTCGGCGTCGGCCGAAGCTGGCGATTGTCGGCATGGCCGGGCGCT
TCCCAGACGCAGCTAGCCATGAGAAGCTGTGGGAGCTGCTGGCCAAGGGCCTGGACGTGCACCGGGTGGTGCCCAAGGAG
CGGTTCCCGGCCGAGACACACGTGGACCCGAGCGGCAAGGCGGTCAACACGAGCCACACGCCGTATGGTTGCTTCATCGA
GAACCCGGGTCTCTTCGACCCGCGATTCTTCAACATGTCGCCGCGCGAGGCGCTGCAGACGGACCCCATGCAGCGCATGG
CGCTGACGACGGCCTACGAAGCGCTGGAGATGTCGGGCTATGTGCCCAATCGGACGCCGAGCACGCGGCTCGACCGCATC
GGTACGTTCTACGGACAGACGTCGGACGACTGGCGCGAGATCAACGCAGCCCAGGAGGTCGACACATACTACATCACAGG
CGGCGTGCGGGCGTTTGGCCCCGGCCGGATCAACTACCACTTTGGCTTCAGTGGTCCCAGCCTGAACATCGACACGGCCT
GTTCCAGCAGTGCGGCGGCCATGAACGTGGCCTGCACGTCGCTGTGGGCACACGACTGCGACACGGCCATTGTGGGTGGG
CTGTCGTGCATGACCAACTCGGACATCTTTGCCGGCCTCAGCCGAGGACAGTTTCTCTCCAAGACGGGCAACTGCCAAAC
GTTTGACGACGGTGCGGACGGCTACTGCCGCGGCGATGGCTGCGCGTCTGTCATCGTGAAGCGGCTGGAGGATGCCGAGG
CAGACGGGGACAACGTGCTGGCCGTGGTTCTGGGCACGGCTACGAACCACTCGGCTGACGCGATCTCCATCACACACCCC
CACGGACCAACACAGTCGGTGCTCTCGTCGGCGATCCTGAACGATGCCGGAGTCGACCCGCTGGACGTGGACTATGTCGA
AATGCACGGCACGGGCACGCAGGCGGGCGATGGCACGGAGATGCTCTCCGTCACCAACGTGTTTGCTCCAGCTGAACGTC
GTCGACCGGCCGGCCGGCCGCTGTACCTGGGCGCGGTCAAGGCGAACGTCGGCCACGGCGAGGCGGCCTCGGGCGTGACG
GCGCTGATCAAGGTGCTCATGATGATGCAGAAGAGCCTGATCCCGCCACACGTCGGGATCAAGAAGGAGATCAACAAGGG
CTTCCCCAAGGACCTGAGCGAGCGCAACGTCAACATTGCCTTTCACATGACGCCCTTCAAGCGCCACGACGGCCTTCCCC
GGCGGATCTTTGTCAACAACTTCAGCGCTGCCGGCGGCAACACCGGGCTGCTGCTCGAGGACGGCCCTGTCCGGGCACCG
GCCACGGCAGACCCACGCACGAGCCATGTGGTGGCAGTGACGGGCAAGTCCAAGGCGTCGATGCTGCGCAACGCCGAGCG
CCTGGTGGCCTGGATGGCCGAGCACGCCGCCACGCCGCTATCCGACGTGGCCTACACGACCACGGCACGGCGAATCCAGC
ACTACTGGCGGATGAACGTGGTGGCCAGCGACCTGGCTGGCGCTCAGAGCGCGCTCAAGACTCGACTGCAGGGCACCTTT
GCACCGGTCTCGCCGGAGCAGCCCAAGGTGGCCTTCCTCTTCACCGGCCAGGGCTCGCAGTACGCCGGACTGGGCAAGGA
CCTGTACGCTCACTACCAGGTGTTCCGATCGAGCATCGACGAGTTCGAGCAGGTGGCCAAGGTGCACGGGTTCCCGTCGT
TCCTGCCGCTGATTGACGGCAGCGAGCCGGACGTGCAGTCGCTCAGCCCGGTTGTGGTGCAGCTGGGCCTAGCCTGCTTC
GAGATGGCGGTGGCCCGTCTCTGGATCTCCTGGGGCGTGCGTCCGGCGGCGGTGCTGGGCCACAGCCTGGGCGAGTACGC
GGCGCTGCACATTGCCGGCGTGCTCTCGGCCAGCGACGCGATCTACCTCGTGGGCGCGCGGGCGCAGCTGCTAGTCAAGG
CTTGCACGGCAGGCACGCACGCGATGCTGGCGGTACAGGGCTCGGTGTCGGTGGTCAAGGACGCGCTCGGCGAGCTGGCC
GAGACGGTCAACGTGGCATGCATCAACGGGCCGCGCGAGACAGTACTGAGCGGCACAGCAGCCGAGGTGGCCGAGCTGGC
CACGATCCTGGGTGACAACGGGTTCAAGTGCACGCAGCTCAAGGTGCCGTTCGCCTTCCACTCGGCGCAGGTGGACGCGA
TCCTGGACGACTTTGAGCGTCTGGCCGGCGGGGTCTGCTTCCAGAAGCCGACGGTGCCGGTCATCTCGCCGCTACTAGGC
AAGCTGATCGGAGTGGAGGACGGTGCGGGCAAGATCAACGGGGCGTATCTGCGTGACCACGCGCGCGAAGCGGTCAACTT
CCTCGGTGGACTCGTTTCGGCACAACAGGCCGGCACGATCGACGAGAAGACGGTCTGGCTCGAGGTCGGGCCGCATCCAG
TATGCGCCAACATGGTCAAGGCGGCCTTTGGGGCGACGACGATTGCGGTGCCGACGGTTCGGCGGGCCGAGGTGGCTGAC
AAGACGCTGAGCACGACGCTGAGCACGCTGCACGCGGCCGGACTCAACGTGGACTGGAACGAGCTGCACCGCGACTTTGT
GGCATCGACACGGCTGTTGGACCTGCCGACGTACGCGTTCGACGAGAAGAACTACTGGCTGCAGTACTCGGGCGACTGGA
GCCTGACGAAGAACCGCGGAGCAGCATCGCTGAAGACGGCGGTGGCGGCCATCGAGCCAGCCAAGCCGAAGCTGTCGACG
TCGAGCGTGCAGGAGGTGGTGCACGAATTGGTCAAAGGTGACACGATCACGATCGACGCCGAGTCCGATCTGCTGCGCGA
AGACCTGCGACCGGCACTGATGGGCCACCTGGTCAACGGGGCACCGCTCTGCCCATCTACGCTGTACGCCGACATGGCGC
TGACACTGGGCGACTACGCGTACCGGCTGGCACGACCAGAGGCCGACGATGCAGCCGTGGCCAAGATCGGGATCAACGTG
GCCAACGTGGAGGTGACCAAGACGCTGATCCTGGACGAGTCGGGCAGCAGCCACATGCTGTACATCGCGGCCAGAGGCAG
CATCGCGGACGGCTACCTGGACATATCGTTCAGCGCGGGCGAAGGCGCCAAGCGGACAGTCCACGGAACCTGTCGGGTGC
TCTACGGCGACAAGGAGCGGTGGTGCGACGAGTTTGAGCGGGTCAGCTACCTGATCCGTGGACGGGTCGACGCGCTGCAC
GCGGGCGAGGCGCAGGGCACGGCATCCAAGGTGAGCCGTGGTATGGCCTACAAGCTCTTCACGGCGCTGGTGGACTACGC
TCCCTACTACCGCGGCATGGACGAGGTGATCATCGACAGCCAGCAGTGCGAGGCCACGGCCAAGGTCCAGTTCCAGACAG
CCGGCATGCAGGACAACTTTTTCTTCAACCCGTACTGGATCGACAGCATGTGCCACATCTCGGGCTTCATCGTCAACGCC
ACGGATGCGATCGACTCACGCAACCAGGTCTTCATCTCGCACGGCTGGGGCTCGCTGCGCTTTGTCGAGCGGCCGGACGT
GGCCAAGACGTACCGCAGCTACATCCGGATGCAGCCGGTCAAGGGCACCACGATGTATGCCGGCGATGCGTATGTGTTTG
ACGGCGACCGCATCATCGGCGTGGCCGGCGACGTGCGCTTTGCCGCGGTGCCGCGCAAGGTGCTCAACCTGGTGTTGCCG
CCTCGCGGATCGGCTGCGGTGACCGGAGCAGCAGCTGCGGCCACTGTGCCGGCAGCCCGCACCAAAGCGGCAGCCAAGAC
GGCGGCAGCCCGGAACAAGAAGGTGGTGACGCACGCCAACATTGGCAAGGTCAACCAAAAGCTCAAGTCGATCACCAGCG
AGGTGATGGACATTCTGGCGACGGAAGTGGGCGTGTCGCACGACGAGCTGGACGACAATATTGCGTTTGCCGACCTGGGC
GTCGACTCGCTGATGGCACTGACAGTCAGCGGGCGCATCCGCGAGGAGCTCGACCTGGACCTGCACTCGAACGTGTTTGT
GGACCAGCCGACGATCGGCAGCTTCAAGGGCTATCTGGCCCAGTTCGAGACCGGACGTCAGCGCAACCCGTCGACCGAGG
ACTCGGGCTCCAGCGACGACTCGGAGGTCGACGAGCTCAAGTCGGACTCGGACGTGACCACGCCCATGGACGACAGTGAG
AACGGCTCGGTCAAGGGGGGAGGCGAAGGTCCTGCCGGTCTGCAGCAGGCCGTGCGCGAGACCATCTCCGAGGAGATGGG
CGTCGAGGTCGACGAGATCCTGGCTGCACCGGACCTGGCCAACCTGGGCATGGACTCGCTGATGAGCCTGCAGATCCTGG
GATCTCTGCGCGAGAAGACGGGCATTGACATCCCGTCAGACCTCTTCGTGTCGAACCCGTCGCTGAAGGAGGTCGAGCGG
GCTCTCGGAATCGAGGACCGGCCAGCGACGACGACCCAGAAGAAGGCCTCGTCCACGCCCGAGGACAAGACCGTGTCGTT
CACCCAGAGCGTGATCCGGCTGGAGTCAGCCGACCCGTTTGAGAAGTTGCCGCCACCCACGTCGATCGTCGACCACTACC
CACACCGCAAGGCCACGTCCGTGCTGCTGCAGGGTCGTCAGCGCACGGCGACGCACAACCTCTTCATCGTGCCGGACGGC
AGCGGCAGCGCCACATCCTACACCGAGATCGACGAGATTGGCCGCGACTGGGCCGTCTGGGGCCTCTTCTCGCCCTTTAT
GAAGACGCCAGAGGAGTACAACTGCGGCGTCTACGGGATGGCGGCCAAGTTCATCGTCGAGATCAAGCGGCGCCAGGCGA
CCGGACCCTACAGTCTGGCGGGCTGGTCGGCCGGCGGCGTGATCGCGTACGAGATTGTCCACCAGCTGATCAAGGCCGGT
GATGAGGTGGCGCACATCGTCTTCATCGACGCGCCGTGTCCCGTCACGATCGAGCCGCTGCCCAAGGGTCTGCACGCCTG
GTTTGCCAGCATCGGGCTGCTGGGTGACGGTGACGCCGACAAGGTGCCGGCCTGGCTGCTGCCGCATTTTGCCGCCTCGG
TCACAGCCCTGTCCAACTACACGGCCGAGCCGATCCCCAAGGACCGCTGCCCCAAGGTCGTGCTGATCTGGTGCGAGGAC
GGCGTGTGCCACCTGCCGACAGACCCGCGCCCGGAGCCGTATCCGGAGGGCCATGCGCTCTTCCTGCTGGACAACCGCAC
CGACTTTGGCCCGAACCGGTGGGACGAGTTCCTGGACGTGGACAAGATGATGATCCGGCACATGCCGGGCAATCACTTCT
CGATGATGCACGGAGACTTGGTAAGTCTGCTTTACCCGTGTCCTTTTTCCTGGCAGCAGCTAACATCTTTAGGCCAAACA
GCTTGGAAAGTTTATGCGTGAAGGGCTCAAGGCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62