GenePrediction:GLEAN_1847 Details

Name: GLEAN_1847
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1526238..1532673 (+ strand)
Length: 6436
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1526238..1527103 (+ strand)
Length: 866
Type: CDS
Source: GLEAN
Position: GCSC_144:1527192..1527867 (+ strand)
Length: 676
Type: CDS
Source: GLEAN
Position: GCSC_144:1528003..1528880 (+ strand)
Length: 878
Type: CDS
Source: GLEAN
Position: GCSC_144:1529286..1529469 (+ strand)
Length: 184
Type: CDS
Source: GLEAN
Position: GCSC_144:1529518..1532673 (+ strand)
Length: 3156
>GLEAN_1847 class=GenePrediction position=GCSC_144:1526238..1532673 (+ strand)
ATGACGGCCGACGACGTGTCTGCAGCCAAGCTCAGCCCGCGAAAGCAGCGGCAGAGCAAGCCGCTGTCAGACTCGTTCTT
TGGGGCCAGAGATATCACCAGCACGCCGTCCGCGGCAGCGCCGGCGTCGTCGCAGCTGCTGTCGTCGTCACCGGCCTTTG
CGACACCGCTGCACCCGATCCGGCCGTTCAACCCGCACGGAGGGGCGGCGACGACGGGGCCAGCGGCCAAGCCGACAATT
CTGCCGATCCTTCTGCCACCGGCGACGCTGCGTCCGCTTGCGTTCCGCACGTTTACCAAGAAGCACAGCCTGACGCTGAC
GTCGTCGGCGCTGCAGGAGCTGGCGGCCTTTATCGGGCGGCACTGCGGGTCCGGATGGCGAGAGGAGGGCCTGGCCGAGC
GAGTGCTGGAAGAGACGGCCAAGAGCTGGAAGAACCGCAATTGCGGCTTCATCGTGGACGGATCCAGCGCCGAGCTCAAG
GACATCCTCAAGTCGCTGGAGGGCAACATGAGCGGCGGCCGGGTAGTGCATGGCGGATCGAGCGGCGCAGGCGGCAGCAG
CAGCAGCAGTAGCAGAAGCAAAGATAACAGCGGCGGCAATAATGGAGTGACCCTCGGCGGGATCACGCGGCAGGACAGCC
TGAGGCTGGATGCATCGCACGAGTCGGAGATCACCAGCACGCGGTTGGGACTGCGGCCGGCGCTGCACGCAGGACGGCCG
GCGCTGCTGGCACGCGAAGACAGCCAGGTGAGCACAGGCTTAGACGGCAGCATGGAGGTGGACGACGACGGCGTGGATGA
TGACGGCTTGGCCGACCCACGGCGATGGCTGCAGGTGATTGGGGCCTTTGACCAGCCGCGGATGCTGTACAACACGACGA
AAAAGCACTTTGAGAGGTGAGAGAGAGAGAGCGAGAGAGCGAGAGAGAGAGAGAGACGAACTGACTGCTCTTAGGGACAC
ATCGAAACCATCGCTGCTGCCTAATATCAGCCAGAAGACGAGCGTTTTCCGCAATCGGTTCAACGTGATCCACCAGCGGC
TGTTGCGCAACGACATGTTCCAGAGCTCGGCGGTGGCCGAGGCGCGGGCGGTGGCCACGCTGCAATCGGCGTCTCTGTCG
TCGTCGTCGCTGTCGCAGACGCATCGGATCACGCCGGTGGCCAACCTGCTGGGCCGCCACGGGACACACCACATGCTGCT
GGGGATGCTAGTGGTGCTGCCGACGGGCAAGCTATCGATCTGCGACCTGTCAGCATCAATAACGCTAGACTTGAGCAGCG
CAGTGGCGATCCCGGAGGACTCGGCGTGGTTCGCGCCCGGGATGATCGTGCTGGTGGATGGAGTGTACGAAGAGGAGGAG
GAATCGGCAGGCCGCGGGCTGAACGGGGCGACGGGCGTGGGCGGCACGATTGGCGGTCGCTTTCAGGCCTTTTTCATGGG
CCAGCCACCGAGCGAGAAGCGGCGGGTTTCGCTGGGAATCAGCGGGCCAGATGGCGGCCAGGACCACACGATCGGGGGGG
GGTTTGGCTGGATCGACTTTCTGGGCGTCGGCAGCCAGCGGGCAGTCGGAGCACGGATGCGCAAGCTGGAGCAGCGGCTG
CTACAGCGACAGCAGAGGAGGGGGGTGGAAGTGGAGATGGAGGCGAGGAGGATGGAGGAAGAGATGGAGACAGACTCGCA
AACTCAAACACAAACACAAACACAAACACAAACACAAACACAAACACAGACACAAACGCAAACGCAATCACAACCACAAC
CACAGACACAACCACAACATCCAGGACGACATCGTGTGGTGGTTCTCGGCGAGGTCAACCTGGACCAGCCACAGGCATTG
CAGGCGCTCAAGAAGATCCTCGGGCTGTACGCATCAGAGGCAGAAGGGTCGACGCCGGTGGCGTTTGTGCTGGCCGGCAG
CTTCACGGAGCACGCAGTGATGGCACGCGGCGGCAGCGGTGGCAGCATCGAATACAAGGAGTACTTTGACGCGTTGGCCT
CGACGTTAGCCGACTTTCCGAGCCTGCTGCAGTCGGCCACGTTTGTCTTTGTGCCGGGCGACAACGACGGCTGGGTGTCG
TCGTTTGGCGCCGGTGCCGCCGTGCCGCTGCCGCGCAAGCCGGTGCCCGACCTGTTCACGTCGCGCGTGCGGCGAGCCTT
TGCAACAGCCAACGCCGAGGCCGGTCTGGCCGATGGTCGTGGCGGCGAGGCCGTCTGGACCACCAACCCGAGCCGGCTGT
CGCTCTTTGGACCCAGCCACGAGATCGTGCTCTTCCGCGACGACATCTCGAGCCGGCTGCGACGCACGGCCGTCCGGCTG
GCATCCAAGGCTGGCGAGATGGAGGTGGATGAAAGTCAAGGCAGCCATGGCAGCCAAAACACACCCATTCCCCACGATCT
CCAGACAGCCCGAAAGCTCGTCAAGACCGTGCTCGACCAGGGCTACCTGGCCCCTTTCCGACAGCCGATCCGGCCGGTGC
ACTGGGACTTTGCCGGCGCTCTGCACCTCTACCCCCTGCCGACGGTCATGGTGCTGATCGACACGACCACGCCGCCCTTT
TGCGTCACCTACGAGGGCTGTCATGTCATGAATCCCGGCAGTCTGCTGGTGGCCGGCCGTCGCGGCACTGCTCGCTGGGT
CGAGTACGAGATCGGTCGCGCCGGCACATTGCGGGAGTGCTCTTTCTAAGGGTCGTGTGTTCTTTGTTTTGTAGACTTCT
GCCATAGGAACGTTTGGCCTGAAAGCCTGTAAGAGAAAGCTCGGAAAGACAGAGTGGACACTGCGCTTCGCCTCAAAGCC
GTTGTGGCTGACGTGGCTTAGTTCGCGTTAGATTTGGCAGGAGCCCACTACGACTGGGTCCCCCCTGGCCCAACTGCCAG
CCCCGCAGTTTTAATGAACAGCAGAGGCAAAAGGAAAGCCAAAAACTAAAAGCTAAAAAGGGCCACCATCCCTCAAGTCT
TCCAACAGCCGCAAAGCGTGCAGGTCAGCGATTCTCCGGCTCAGGTCGACGCGATTTTGGCAGTCTCCTGGTCTTCTGTC
TGTCTCAGATCCGAGATTCCGAATCCCAAAGCTACACAACGCATCACAGCAGCAGCAGCATGGCCACGAAGTAGCCGGCT
TACCTGTCGCCGTCTCCTGTCTGTCTTTCCGACCGTCCCCGCTCTCTTCCGATCTGCGCTGCGCGCCCCCGACATCATGG
CCAGCACCGAGCAGCTCGAGATACACAGCAAGGTATAACCAAAAAGAAAGACAAGTCGGTACCGTCACTAACGCGTACAG
TCCTACATTGTGCGATGGGCCAAGGTCGATGAAGGCCACACCATCTCGTGGAGCGTTCAGCCACACAAGAAGTCCATGTA
CGTTGTCCGTTCTGTCCGCCTCAGCCGCGTGTGGACAGCTTTTAACCAGGCCAGAAATTTTGGCATCGTCAAGCACCCCG
GCACCGGCGTCACCAACCTGACGACATTCCAGTCCGACCTCGATGACAGCAGCAGCATCCTGGCCGACGGCACGTCCGAG
GCCAAGGCCGGGCTCTTTGCCAACAAAGGCTCGGCCCCGGAACAGCTGCGCAAAAAGGGCTTCAAGGTGATCCAATGGCA
CGGCAAGTGTGATGCCGACAAGGTCTCCGTCGGCACGTACGACGTGCAGCCGGGTGAAGCCGGCATGTTCGGCCTCGTCT
TCGACAACACCTTTTCCAAGCAGACGTCCAAGAACGCAACCTTTAACTTGCAGATCATCTCGACCGACACACCGCCACAG
GCCGGTCAGCGTCTGCCCAACCTGCAGGCCCCAGCCTATGCCACCGGCAGCGGCACCAGTCTGGCCCGCACGCTCAACCC
GCAGCTGACTGCGGCCGCGTCCGAGTCGGTTGACAGCCTGGGCAGCCACAATGCGCCGGCCAGCAACAGCATCGTGGGTG
TCACCAGCACGACCGGCAACGCCGGACAGCCCGTCGTCCTGACGGCTGCGGCCCAGAGCCTGGCCTCGCCGGCAAACTAC
CACGTCGGCTCGCTGATGAAGCGGCGCCGGAAGAAGGGCCAGGGCTATGCGCGGCGTTTCTTCTCGCTCGACTACGCCAC
CTGCACGCTTTCGTACTACTACAATCGCAACTCGTCGGCCCTGCGCGGAGCCATCCCGCTGAGCCTGGCGGCCATCGCGG
CAGACGAACGACGCCGTGAGATCACCGTCGACTCGGGCGCCGAGGTGTGGCACCTCAAGGCGTCCAGCGTCAAGGAGTTT
ACCGACTGGGGCCACGCACTGGAGCGGGCCAGCCGCATCGCCCGCGGCCTACAGCAGGGCCGGGCAGCCGACGACCACAA
GCAGCCGACCGAGAACAAGTCAGCCGACACAGCGCCACAGCACCTGCAAATGCTACAGGAAGGCGAACGCGAGTGGCAGC
AGGTGGAGGCGCTGGTCAGCCGCGTCGTGGGCACGCGGGACGCTCTCCGGCGTCTGGTCAAGAGCACGGCTGCGCAGCAG
CACCTCAACCAGATGCACGCAGCGCCGGCAGTCCAGCACCTGTCGCCACCAGAAGACGCCGACGAGAACGTGCCATCGCC
GCCAGGGCCACAGCAGGTCGACCGCAAACCGTTTTGGCGGCGCAAGTCCTCTGCAGCCACGACGCCGATGAGTCCGCAGA
GCTTCCAGCCGCCAGTGCCGGCGCTGCCATCAGCGCTGACCATTCCAGTGTCGTCGGGCGCGTCCATCGTGACAATGGCC
AGCGGCAAGATCGCCGGAGGCCAGCGCGGCCGTTCCGGCAGCTCAGGGACAAACGCCGAAGAGGACTCGATGCACGGACA
CTGCCAGGCGCTCCTGGACGACCTCGACTCAGTGGTATCGGAGTTTACGAACCTGCTGGCCACCAGCAAGCAGCGCCGTA
CAGCCGCGGTCGCTGCAGTGAACAACACAGCTTCGGCGGTGAGCAGTAGCGGCGGCGGCGGTGGGATCCCGCGCAGGAGC
ATGGACTCGACGACGTCGGACGAGTTCTTTGACGCAGCCGAGGGCGATACGACGCGGCCACAGGTGCTGCGGATAGACGC
GCACAGCGAGGCGGAAGACACGCCAGGCACAGACGGCGAGGAGGCGTCGCTGCACGATGAGTCATCCGTATCGTCAGTGG
AAGGCGAAGAGGAGTACGAGGGCGCAGGAGCGGGCGGCGACGACGAGGATGGCAACGGGAACGGCAGTCCGGAGAGCCTG
TTCCCGGCGAAGCCCAAGTCGCTGACGCCACTGCCGGTAACGGAATTGGTGAAGCGGCGGACGACAATCCCACGGTCGAC
GGTGATGCCGCCCAGTCTGATCGCGTTTGTGCGCAAGAACGTGGGCAAAGACCTGTCGACAATCTCGATGCCGGCATCGG
CCAACGAGCCGCTGTCGATGCTGCAGCGGGTGGCCGAACAGCTGGAGTACGCGCAGCTGCTAGACGCAGCAGTGACGAAG
AAGCGAGCAGACGAGCGGCTGCTCTACATGGCGGCCTTTGCAGTGTCGCAGTTTGCGGGCGGACGAGTGAAGGAGCGGTC
GATCCGCAAGCCGTGGAACCCGCTGCTGGGCGAGACGTTTGAGCTGGTGCGCACAGAGACGGACGTTCCCGGGGGCCTGC
GGCTGCTGGTGGAAAAGGTGAGCCACCGGCCGGTGCGACTGGTGATGCAGGCAGACGCGGCAGCCTGGTCGTTTGCGCAG
GCGCCAGCGCCGTCGCAGAAGTTTTGGGGCAAGAGCGCGGAGATCGTGACGGAGGGCCGAGTGCGCGTGGTGCTACGGCT
GCCGGACGGCACGGAGGAGAAGTACTCGTGGACGCTGGCGACAGTCTTCTTGCGCAACGTTGTCGTGGGCGAGAAATATG
TGGAGCCGGTAGGGACGATGCACGTGATCAACGACAGCACAGGTGCCAAGGCGGCCATCGAGTTCCGGTCCAAGGGCATG
TTTGGCGGCCGCGGCGAGGACGTGCAGATCGACGCGCTGGACAGCACGGGTGCCCGCACGGGTCTGTCGGTGACCGGCAC
CTGGACGCAGTCGCTGCGGCTGGTGGAGCAGGGTGGCGGCAGCGGCACCGAGATCTGGCGAGCCGGCCCCCTGGTCGACG
ACGCCGCACACGTCTACGGGCTGACACGCTTTGCCGCCTCGCTCAACGAGATCACCGCGCTAGAGCGTGGCCGCATGGCC
CCGACCGATACCCGGCTCCGGCCGGACCAGCGGCTCGCCGAGGACGGCAACCTGGACGAGGCCGAGGCCTGGAAGACCCG
TCTTGAGGAGGCCCAGCGCACGCGGCGCCGCCAGGCCGAGGAGCGCGGCGAAGAACACCGTTCCCGCTGGTTTGTCAAGG
TGGCCACTGGACCCGACGGCGACGAGGTCTGGCGTCTCAAGGGCGGCAAGGACGGCTACTGGGAGGAGCGCGCGCGCGGC
GTCTGGACCGGCCTCGACGATCTGTATTCTGTCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62