GenePrediction:GLEAN_1849 Details

Name: GLEAN_1849
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1536046..1536990 (+ strand)
Length: 945
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1536046..1536253 (+ strand)
Length: 208
Type: CDS
Source: GLEAN
Position: GCSC_144:1536320..1536362 (+ strand)
Length: 43
Type: CDS
Source: GLEAN
Position: GCSC_144:1536420..1536554 (+ strand)
Length: 135
Type: CDS
Source: GLEAN
Position: GCSC_144:1536615..1536990 (+ strand)
Length: 376
>GLEAN_1849 class=GenePrediction position=GCSC_144:1536046..1536990 (+ strand)
ATGAAGTCCAACGTTGCCACTCTGTTCCCCAACGTGAAGGTGGCTACAAATGTCATTGAGTATGCCGCGGCCAAGTCCGA
CATCCTGCCCGAGCCGCTGCTCAAGTACCATGCCTACATCCTGCGGCTGGAGCAGGCCGAGTTGACCATCTCCACGTTCC
AGGCCCAGGCACTCAGCTTCCTGGCCAAAACGGCTGGAGCGAAACGTGGTAGGCTTCCGTAGTCTGTGCACCGTGCGGAT
GCTATGGAAATGGTGCTGACAACTCGCCCTGCAGTCTTGGAGATTGGCGTCTTCCGCGGCTTTTCCTCCATGGTCTGGTG
AGACGCACGGCGTTCCCGAGAAGCAGCGATGCCGATGTGCTGACCCACCGTCAGGTCCAATGCAGTCGGCCCTAGCGGAA
CGGTCACTGGCCTGGAAATGGACGAAAAATATGCCGATTATGCCAGGCTCGGCTTTGCCGACGTTGGCGTGAAAAATGCA
GAGATCATCGTCGGCGATGCCCTGAAAACGTATGTCCCCCTCGCATGAAACAGATGCTGCACCGACGATGCTGAGACCGG
CACGGCCAGACTCGCCGCTCTGGACCCAGAGGAGCCGTACGACCTCATCTTCATCGACGCACAAAAGACCGGCTACCCCG
CCTACCTCCAGACGATCCTGGAGAAGTCGGCACCGGGCGCGCCACGTCGTCTGCTGCGTCAGGGTGGCCTCATCGTCGCC
GACAACGTGCTGCGGCGTGGCCTCGTCGCCGACTACAGCGCAGACAACCCGGCTGCCGTGAAGGCGGCGCATCTGGTTGC
CGCGTCGGTCGACGGGAAGAGTGACAGCATCGAGGCCCTGAAGGCGCTGGACGCGTTCAGCTCGGCGATGCGGGAGAACA
GCCGGATCGACTCGCTCTTGGTCCCGCTCTTTGACGGCATTGCGCTGGGCCGTCTGGAAGACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62