GenePrediction:GLEAN_1850 Details

Name: GLEAN_1850
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1542260..1546743 (+ strand)
Length: 4484
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1542260..1545187 (+ strand)
Length: 2928
Type: CDS
Source: GLEAN
Position: GCSC_144:1545259..1546743 (+ strand)
Length: 1485
>GLEAN_1850 class=GenePrediction position=GCSC_144:1542260..1546743 (+ strand)
ATGAGCCGTCCTTCTAATGAGGCGGGCGCGCCTCGACCTGCCTCTGGCCTCGCCTCTCACAACAACATCCGATCACGAGC
CCATAGCATCTCGAGTGACCGACCATCTACCGTCGGCTACGGCTTGATGTCGCCACCGATATCTGTCTCTCCGGAGGCAG
CTTTCATTGCTGCCTCGGCTGCCTCCCAGATCGTCACAAACGACCATGACAGCCACGCCAACACCTGGTACGATGAGCAT
GGCATTGAGCCATCAGGGGAGACGGCCATCGTCACTAATGCAGCACTGCAACTCATCAACAACTTTCTTGATCAGCTTCT
CTTCAGCTTTCTCTCTCTTTCCCATTCCACGTCTCTCGCAGCTTTACGCCCTGCCGTCACCGAGGTTCTCAAGCCGAAGC
TTGCAAAAGATGCCATCAACCAGGCTGACGAGGAGCTGCGAGAATACCTTGGGGGTGGAGACGATGACGACATGCTCCAG
TCACAGCGGCCCACTTCGGCGAAGGACTGGGATGTAGAACTTGTCTGGAAACGCACACGCCTTCGCTGCATGGTCTATTC
GTCGCTGGGCGACTTAGAGGAGGAAGATGAGGACCTTTACATGGAGCAGGAGCATCTCGAAACTGCCCACGATCCCACAA
GTGAGACGGTGTCTCCAGCTGTGTCAATTTTCCTGACATCGATTCTTGAATTCATGGCCGAACAGGCTTTGATTTCGGCT
AGTCAAGCTGCCTTCCATCGCATGCGCTTTATATACGAGAAAGACCGCAGGGACCCCACCTCACCAAGACCAACACTAAT
CGCAAATCGAATTACAGTTGAGGAGGTTGACATGGAGCGCGTCGCATTTGATCGTACCATTGGGCGGCTGTGGCGATCAT
GGAAGAAGAGAATAAGGTCTCCCACGATCGATGTCCACCACTCCTTGCCGGGACCATTCTCGGACGATGCCAGCCGCCCG
AGTATACATTTGAGGCAGTACAGTGAAAACGTCGAGGAAGGCGCCAATGCTAAGCTGGCTTCTGAGCTAGTTGAGGCTGA
AAACAACAGAACAAAGAATGAGCCCCGACAGTTGACAAAGGAAGACGGCCACAATGCAGTGCAGATACAAGAACAATCAG
AACATTCGCCACAACACATCGTGATACCGCTTTCAGAAAGGGCCACAGCCTATATGACAAACGAAGAATGGCTGAGCGCA
GCCATTGCGGTGCCCCTACCGACCAACGAGAGGGATATCGCCGAGATCCTCATCCCTGGCTTCACCCACTATGACGACGA
AGAGGCGCCCGTGGACCGTGATGATGGAATCGACGTTCAGGTTGGTAAGAAGTGGGGAAGACTAGACGATAAGGGACGAC
GACCACAGAGTCTCTTGATCCCACCAAGTGCTCTTACGATTGGACTGCCCACTCCTACTACATCCGAACCACACACACCC
GAGTTGCCTTCTCGGAAACGAGCAAACTCACTGCCAACGCCTACAACGTCACCCTTCTCATCTCCACGGACGAAGCGGGT
CAAGGCTGCCGAAGGCGATTCTCTAGCTGCTATGGAGGAAGCCGCTCCGGTCTCAGAAGAGGCAAACGCAGAGGGTGCGA
AAGAATACGTAGCACCTGATAGTAAGCAGAAGCGCGGTAGACTGGTTCCTCCTCTTATCACCACCACAATCGGGGCAGCT
ATAACCACAAACTCGGCGAGAGCGGTTCCTATAGCCGGTATGATGACTGAGGAGCAGTCGGACAACGGCGATGAAATCGA
TGAGGAGTTTGATGAGTTTACAGAGGAGCCTGAGATTCTCACATCTTCTCGCATTTCTATTTCCGGCCGCAGCAACTCTC
CGACCACGTCCGACCTAGGACGACCACTGTCCATCTGTCCGATTCTCTCCCCTGGCTCGCCGAACCCGCATTCGCCTCGG
GTCATCGATGTTACTGGTCCCCGCAGCCCCATCTCGAGATCGAGGGGTAGCTCGATTGACGCACAAGATATGGTGCTGTC
TCTGTCGCGCGTCAGTGATCTTTCCCGCGCCAGCAGCATCTCAACTCAGCCTATTGCTGAAGAGGATCACAGCCCCTCAG
AGGCAACAGCTGCGCCAAAGGTGCCTTTGATCGGCGTGAAAACGCCGAGGGCCTACAAGAGCGAGTCGATATCCGAAGCT
GAAGAAGCCGATGCCGAGCCAGTACAGAGCACGCGCAAAATTGAAACCGTTTCAGCTCTTGCTGTGATGCCGAAGCCAAT
AGAGGCAGTACAAGCCCAGCCGCAATTGACCGAACCGGTCAAGGATTCTGCTGTCTCAGCTGATGCTTACTCGACCCCGA
TTTCGTCACCGCTACACCCGTTGCCGCCTCCACTGGATTCTAATTATGGTACTAAGGTTACGATCCTGGGCCCCACGGCA
CTGTCCGGCAGCTTCTTCATCGACGACACACAACAAGACGATGTAGCAGAGCAGCCACAGGAAATTTCAAAAGTAGCCCC
GATTTCGATTCCCGAACGCAGCTCGAAACGTGAGGCGTTCAATGCTTCCTCCGTGACAGCAGCTGCAGTAACAGTTGCGG
TTGCAACTGCTGCCAGTGCGGGCAGTTTTGTCCAACGCTCCAGGTCCCTACGAGAAACACGTTCTCCTCTCGGTGCTTCG
GAGCGCCCCTTGTCTATCATCAGCCAAGAACCGGACGTGCTGACCGAGGCTAATCAATCTCAAATGCACGCTCAGTCGTC
AGCACAGTCCCCATCAAGCGATGCTCAGCCGAGTCATACAGCGGATTCTTCGATGTCGTCGATAGGAAGTAAACTGAAGC
CAGTGCGAACGTCTGAAGAAAACATTGTCATCCGGTCTGAGGATGTTGCTCGCAACTTTGAACAGCTCATCCAAAGCGAC
CAAACGATCCAGTACACTCTTACACCCGAGAACATGCGTGATATAGATGTGAGCTACTGCCAAATTTCCAGATTCTGACT
GGACTGCCACAGACGTACTAACCATGCCCAACACTACAGGCAACAAGGTCTTCGTATGAAGGAAGCATCCTGCCAAAGAG
CAGGAGAAGCGAGGATACTCGGCCAACTGGCGACCGATCGCGGTCATCATCGTTGGCCACCAACAAGCAGTCAGACATCA
GACGATCGCCGTCTATTGCCTCGCGGACAACGGCAAACGAAGCGTTATCAGCAGAGACGACACAGAACCAACGGCTGAAT
GGCCCAGTGCCGCGCCTACCACATCGCCTTACGGCGTCGGTGTCATCTGCATCGTTGAGATCGCGACCCAACGCGCCACA
GGCCCGAGATGCCAGAATCCCTCAAGAATCGCTTGCGGATTTCGCCGAGTTCATCCGGGCTACGGGCCCGTCGGTTGATG
AGGGGCGCAGTGCAGTGCTGCGTAAGAACAGCGGTGGTGGTGGCGGAAGGCCAACAACCAGTACTTCACGCAATGTCAGC
AGCCCAGCAACGATGATCAAGAGTAGTCTCGGCAGGAAATTGTCGGCGGCTGGAAGCAGCCGTTCACGTTTCCAGGCGCG
CGGGGCGACAGTAGACTACAAGGACGACAAGTCTGATCTGATCGACTTCATTCGCCGCGGACCTCCAGAGACAGCCGAAA
ACCCTCGGATCCCTCGGACAGTGGCCCCATTCCAGACTCCGATGGATTCAGACCAGATGGCAGGCGCAGCCGGTGGTCGG
GCGGTCGATGCCACGATCTCCAGTCTCCGCTACAGCGCATCCACCAATGTGACGGAAAGCTCGGTGAACTCGTCGACCGG
TCTTCTCAGGAACAAGGCTTCGCCACCTGGCGGTGCGGTCAGCAATAATAACACGTTTGACGCACCGGATGCAATGCCGA
AGCGGAAGACGCGCCGGGTCAAGGATCCCTATGCGATTGATCTGAGCGACGAGGATGATGAAGAACTGTACGCCAGTGTT
GGGCGTGGACCCAAGCCGGCGGCCAAGGAAGAGAGTCTGCTGGACTTCCTGAACAGTGTTCCGCCACCACCGGAGCCGCA
GCGACGACCTTTCGACGTTCCGCAGACACGATCACAGAAACAGGCACCGCGAAAGAAGGCGAGCACGTCAAGCCTGATGT
CACGGTTTGCTTGGGGCAGCAGCAGTCATAGTCACTCCGGAAGCACGGGCGGACGCGGACTATTCTCCAGCAGCGGTGGA
GAAGGGAGCTCGTTCAAGGGCAGCAGATCGGAAGCGCGATCGTTGAGCAGTCGTGCTGGGTCGGCCATCATGGGTCGTGG
ACACGTTCCGATTCAGGCGCACATTCCGGAGAACGTGGACAAGTACGGTACAACGACGGTGGTGTCTAGCACTACCAATG
GGGTGAGCACCAGCCTTAACAACAACACCGGTACTGCTGGAAGCTCTGGGCGGGTGCTAGGAAAGAAGTATGAGCCACGA
GAGGCTCAGAATGTGCCGTCTGCTACGCGAGACCTGGCCGAGTTCTTCCGCAATTCTGGGCCAGCACAGCCGCAACGAGG
GTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62