GenePrediction:GLEAN_1851 Details

Name: GLEAN_1851
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1547687..1548253 (+ strand)
Length: 567
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1547687..1547731 (+ strand)
Length: 45
Type: CDS
Source: GLEAN
Position: GCSC_144:1547804..1548253 (+ strand)
Length: 450
>GLEAN_1851 class=GenePrediction position=GCSC_144:1547687..1548253 (+ strand)
ATGTTGTTGGCAGACCTACTTAGCATGGCTCTCCGCCTGGCAGAGGTGAGTACTTCTCCTGACGGTTGTTGAACGGAGAA
GCTGTGTGGAAGTGCCGATGTCTAAGACGAACTCTAGCTGGCGTTTGCAGCCATTGTGGCCGGCCTCTCGGGCAGCTACC
TGCACTCGATGCGCGGCACGTCGTCGTGGCACCTGCGGCGGTTCATCTATGCCGAGGTGGTGGCTGGACTTTCGATCCTG
CTGTCGATTGTGTGGCTCTTCCCGTTTGCGGGCAGCTTCATCCACTGGCCGGTCGACATCGTCCTGGCGGCTACCTGGTT
TACCGTGTTTGGGCTGCTGGTCAACTGGCTGCACGGTTCGTGTGGCTCCGTGTTCGACTGGCACGGCATCGCGCTGCGTG
GCAGCGCAGCCTGTCCGAAGTGGAAGGCCGACATTGCCTTTAGCTTCCTGTCGGCCATCTGCTGGCTCGTGTCGGGCCTG
CTGGGCATCTACCGGGTCCACCGCCGCCGCTCGGCTCCCGCAGAGGCGCAGCAGCGCCGTGGACGTTGGTACCGAGCGCG
TGTATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62