GenePrediction:GLEAN_1852 Details

Name: GLEAN_1852
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1549066..1550355 (+ strand)
Length: 1290
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1549066..1550114 (+ strand)
Length: 1049
Type: CDS
Source: GLEAN
Position: GCSC_144:1550193..1550355 (+ strand)
Length: 163
>GLEAN_1852 class=GenePrediction position=GCSC_144:1549066..1550355 (+ strand)
ATGTCTTCCATCGTCAATAAGATCAAGGAGGTTGTCAACCCGGACAAGAACAGCGACAGCACTTCGGGCAGCCATGGCTC
CGGCCACCACAACAACGGCCGTCACGACAACGTCTCATCACAGCCGCGCACCGATGCCAGCAGCGGTGCTTTTGACAGCA
CTGGCACCCAGGCCGGTGTAGGAGGTGCTCAGGGCCACAGCAGCCGCCAGACAGCCGGCCAGACTGGACGCACGACTGGC
CAAGCCAGCCGCACCAGCCAGATTCAGGCTGACCAGACGGCTGGCGGCCTTGATGGCAGCGACAGCTACACATATGGCGG
TGCAGACGCCTCGAGCGGCGGAGTTGGAAATCTGTCAGGTGGCGGCATCGGCAGCGGTGGTGCTGTTGGGGGGCGAACAG
CCGGCCACACCGGATCTGGAGTCGCCGGTGGCCGGACGACGGCGGGTACCACGGGGGGCGGCGCAGCCCAGGACCCATCG
TATGCCAGCGGTGGCCTCCAGGACGACACGTATGGCAGCGGCGTCGCTGGCGGCCGGAACACAACGGGCGCCACGGGTGG
TTTCCAGGACGATTCATTCGGAAGCAGCCACAATGCTGGCCGGAACAAGACTGGCGCCTCAGGCGGTCGTCTGGCCCAAG
ACCAGTCGTTTGCCAGCGGTGGCCTTCAGGACGAGACCTACGGAAGCAACATCAGTGGCGGCCGGAACACAACGGGCGCC
ACGGGCGGTTTCCAGGACGACTCATTTGGAAGCAGCCACAATGCCGGCCGAAACACAACTGGCGCTACAGGCGGTCGTCT
GGCCCAGGACCCCTCATATGCCAGCGGCGGCGGCGGTGTCGGCGGACTACAGGACGACACGTATGGCAGCAGCAATACAG
CTGGAGGTGTCGCCGGCAGCGGTGGCAACCTTGGTGCCCGCGTTAAGAACACTGCACAGCAGTACGGCGATAAGCTGACG
GGCGGTCACAATTCCGGAGCCACAAGCGGTCGCACTGCTGGCGGCCGCGGTGGTGCCAGCAATTTTGACGGCAACGATCA
GAGCTACTAGTATGTGGGTGAGTTTTCTAATGGATTTTCATCGATTCGAGACAAACAGTCGGCTGACTCGCAAAGCAATT
CAACTAGCGCCGGTTCTGGTTCTGTCGATCCGACAGACGCTGCTCACGTGCCCCCCTCCGTGCTGAGGAAGCATTTGGGC
GAGCCGTCCATTGCGCACGGCGATCACGGCCATGAACGGGCGCGGCGCAACAGCTCGAACACGCACCAGGAGTCATTTCG
GGGCATTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62