GenePrediction:GLEAN_1853 Details

Name: GLEAN_1853
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1550862..1552106 (+ strand)
Length: 1245
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1550862..1551471 (+ strand)
Length: 610
Type: CDS
Source: GLEAN
Position: GCSC_144:1551642..1551851 (+ strand)
Length: 210
Type: CDS
Source: GLEAN
Position: GCSC_144:1551916..1552106 (+ strand)
Length: 191
>GLEAN_1853 class=GenePrediction position=GCSC_144:1550862..1552106 (+ strand)
ATGGCCTCTCCGTCGATGCGACGGCCGGCTGGGAGCACGCGGATCAGCCAGCATGGGGCGTCGACCAGCGCGGCCGCCCC
GGGCGCATCGCTCGCGCGGATCCTCTGGAGACGACGCGTTCCGCTGCTGATTACCCACGCGTCATTGGGCGGGTTTCCAG
GCGAGTGTTCAGACGGCTCTCCGTCTTCGTCTTCCGCCCCGGCTCCGGCTCCTCTCGTCTTTGCCGCGTCGGTCCCTCGC
TTCGGCTACCTCGCCCAGCTGCTGCCGCGGCTGTCGGCCTTTTTCGGCCGACCCTGCTCCAGCTTCCAGTACGAGAACGT
GCCGCTGCGCAACCTGCCGCTCGGCCTGCTGATGGACCTCTACCTGCCACCGTCGACGACAGATGAGTCGGTCGCCGAGG
CCGGGGCCGAGGCCGAGCCGGCGACAGGCAGAGGCGGCCGGCGGCGGCTGCCCTGGCGGCTGGTCGTCGCCGACGGCGAG
GCCTGGCACCTCGGCGACACCTTTCTCAACGGGGCCAAGGAGGCTGACTACGTGCGGTACGGCAGCGCGAAGCAGATCAT
GAGCCTGAGCAAGGCCAACACAGAGGCTCTCTGGGAGGCTATCCAGGACAGTACGTTAACCTTTCTTTCTTTTTTTTTGC
TTTGTTTCTTTCCTTCCTTCTTTCTTGAATTCATTTTTTTTTCCTTTTTTCTTTCCTTCTTTTTCTTCTTTTCTTCTTTT
CTCTTTTCTCTTTTCTCTTTCTCCTTTCCCCCTTTTCCCTTCTCCCCTGCTAATGACCAGATGACTATGCCACCTTCTCC
CGCGTCAACAACCTGCTGCTCAACGCAGCCGCCCCCCTAAAACACATCCCCCTACGCATCTTCATCCCCTCAACCGCACC
ACCAAAGCGGTCGGTCCTGTCGACACAATCAGCCGCCGCTGAGACACCTCCCTACATCCCCGGATCCTACAAAATCATGC
AGCCCCTGGTGGCGCCTCGCCTTGGCAACCGTACGCCACGCCTTTCTCCTCTCAAACGTCTGCTGATTCTGAACTGCCTC
ACTAACCCCAACAGGACAACCCCAAACGCTCGGCGCTGCCCTACGCAATCTCCTCCCGCTGCTCTTTCCCAGCAGCCGTG
ATCCCGTTCTGGCCAACGTGGTCTTGCACGGCGCTTCCGTGCCGTTCCACACTCCTCTCGAAGAGCTGATGCGCGAGGCT
GCCTATCCCGACGGCTGGCTGGCCCTCGTCGTCGTGCTCTTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62