GenePrediction:GLEAN_1855 Details

Name: GLEAN_1855
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1567250..1568978 (+ strand)
Length: 1729
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1567250..1567482 (+ strand)
Length: 233
Type: CDS
Source: GLEAN
Position: GCSC_144:1567547..1568978 (+ strand)
Length: 1432
>GLEAN_1855 class=GenePrediction position=GCSC_144:1567250..1568978 (+ strand)
ATGAATCAACTCCTCTTTGAAAGATCCACCGGCAACCTCGGCCAAAATGCCTTTGTTCGCCTCCAGTACAGTCAACTGCT
ATACGCATTCCGGCCTGCTTCTCGGCTGCGCTTTAACGGCGGCGAACAAGGCACGAACATAGTGCCCGAGGGCGCCGGAT
CATCCTATCTTGATAGCTGGGCTCACCAATCTGGAGTGAATGCCCTAGCCTTGGAGCGATTTGATGGCCGAATGTAGGCC
ACCTCTTGTTACTCCTCTTTTCATAATCAAGTCACAGGTGATATACTGAAAGCCTAGATTGGTATCGGGTGGTTCAGATG
CTACCATCCGTATATGGGACCTGGAGCAGCGTGACCAGGCAGCACCTGAATATGAATTTCGCCCTGTTGCGCAAATTTCT
CGAGCCGGTATCAGCCAGCAAGACACATCGCTGCGACGCCAGCAGCCGGCCGTTTCAAGAGGTCCGTTATCTAGAAGCGC
CTCTAGCGACGGCCATCGCTTCGGTGTGACACATCTATCGTTTTACCCTTTTGATTCGGCCGCTTTCTTGTCCTCATCCT
ACGACCAAACCCTCAAACTGTGGGCGACTGATCTTGCCCGTCTCTCAGGGTCTTTCGATCTCAGCTCCAAAATATACAGT
CATGCCATCTCCCCTATAGCTGATCACCTGCTTGTGGCCTGCGCGACCCAGCATCCGGCTGTACGGCTTGTGGACCTCCG
GTCTGGTGCAGCCGTCCAATCTCTCGTGGCTCCGGGCCAGGTCGCCGGTGCTGTGTTGTCTGTGGCCTGGTCTCCACGCC
ACGAACATGTTCTTGCGAGCGGTGCCGTCGATGGTAGCGTACGAATCTGGGATGTCCGTCTTGCAAGTAGCCTGGTGGCA
CTGCTGGACCAGGAGGATAGCCTCGGTTTGTCCTCCAGGACGGGCAACGACAACGATGGTCGCATGCCAGTGGTCTCAGC
CCCGTACGAGCGAGGCATACGATTATCAGCCAAGGCTCACACCGGTCCCGTGAACGGACTGACCTGGACGGACGATGGGG
CCTACATTGTTTCTGCTGGCCATGACAGACGAATACGCGTCTGGGATGCTGCCACCGGTGCCAACACGCTCGTGAGCTTT
GGGCCATCTGTTCGCAACGGTGGCTTGACGAGCGTATCGATGGTAGTGTCTCCGACAGGCCTGACACCGCCGAAGAAGGA
GCTGCTCTTCTGGCCTAACGAGTCCGAGATCCTCGTCTTCGGTTTACATGACGGTAGTATTGTCACTCGGCTACGCGGAA
TGGGTCCTACTCAGTTTGCTGTGCGCTTGGCATCGGGTGCCAGCCCAGCTTTCAACAACCCACCCCCCTCTGGAGCCAGA
ATGGGCAGACGGGGCTCTGTCAGTACCGGCAACCGTACCGGTAGAACTGTGGTGCCTGACCGGTCATCTGCCAGGAAGAA
CAGAGTCACTAGCCTTGTGTGGCAAGGAGCGGGGGGGTCAGGCAGCGAGACTGGTGGTGTCAACATGGGCGGTCACGGTG
CCATGGGCGGTGTCTACAGCGGCCATTCGGATGGCCAGATACGCGCGTGGATGCCCCAGCCAGCCGTTGAAAATGGAGGA
GCTGACGACGAAATTGGTGGCGATAGTGACGATGCAACGCCCTCGGCCGTCGAACAGCGTGACCGAAAACGGAGAGCTTT
AGACCAAACCTTCCGCAGTCTCATGGGCACACAGATAACATTCCGGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62