GenePrediction:GLEAN_1857 Details

Name: GLEAN_1857
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1575699..1579449 (+ strand)
Length: 3751
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1575699..1577805 (+ strand)
Length: 2107
Type: CDS
Source: GLEAN
Position: GCSC_144:1577879..1578618 (+ strand)
Length: 740
Type: CDS
Source: GLEAN
Position: GCSC_144:1578673..1579449 (+ strand)
Length: 777
>GLEAN_1857 class=GenePrediction position=GCSC_144:1575699..1579449 (+ strand)
ATGGCTTTTTTGAACAGCAGTGGAGGAACACTCACACTCCCTTCGCCGACGTCGGTTCACCAGGTCGATCCGATCTCGGT
ACGGTCACTTCGACGCTCTCTGTCGAGATCCCCGACGAAGTTCCATCTGGCCCGGACGAGCTCTCAGGCGTCGCATACCT
CCGACAGCTCTGCCAGCTCTTTTCAGATCCCATCGCCCGACTCGCCTTGTCCACAGCCGCAGTTGTCTTACGCTGGCAAC
GCACTTTCGGCCGCGGCATCGTCGACATCGTCCATATCAAGCACCAGCACGAACTCGATCCTTACTGGAGAGGCAGTGCC
GCAGTCGACGTCTCTGTTTTCCACACCGCTTCGCCCCGGAGTACGACTCTCGTTGCGCTCAACCCGGCCTAAGACAGCGA
CATCAAAGCCAATTACACGGTTACGGGCTTCACCAAAGAGTCCGCTAAAGCGCGCTTTGAGCGTGAACGCGGACATGGGG
AACGCAACTACGACACCAATTTCCACTAGCGCCCCATTGATAGCCATGACGGAGCCGGTCCTTGGCAAGGAGAACAACAA
GTTCAGCAACTTTCTGCTGTCATTTGGCTCTGCCGCACGCAACGTCAGTGACAAGTCCTCACGCCACAGCATGCATCTCG
ACCTTTCAGGCGATGCCCGGCCTGAAGCATCTATCCATGTGAGCCCCCGGAAACGAAGTGATGCGACTACGGACTTTGAT
CAGGCAAGCTTCGGCAGCCCGGTCGCAAAACGTCGCAGCTTGCTCGGTTTTTCTGGCGTTGGTAGCGATCTAAACGCTTT
CGATTTCGCATCGCCCAATTCGATACAGACCCCGCGAACATCTTTTGAGGCCCCGACGTCGTTTGAAATTCACGATGACA
TCAAACAGCCCGACGCAGAGCTCATTTCTACAACACCGTCCCCCACGCCTGCTGTTGAGCCGGTCTTTTCAACAACGCCC
ACAACAGCATCAAAGAGAGCATCGACACTACGGAAATCAACTCTCCAGCAGCGCCATGACCCTCGCTCCTCTTGGGGCCG
TCGACAGGGCGAGAAGTACCTAGTCCAGCAGCTACAGCAGCAGCAGCAATTACAAGAACAACAACTGCAGCAATTGCAGC
AGCAGCAGCTGGAGCAGCCGGGTGAGGCTGAGCCGGAAACGTCGAGACGGTCGTCGGGCGAATGGCTCTTTTCGGCTTCT
CATATCCGCAACAAGCCTCGTGCCTCCCTGGAACAGCTCTTGAAGCCGGAACCGCAGGAGAGCCCCTTCAAAATCAAGAG
CGCATTACCCAATGCCTCGCAGCTCGTCGTGGACCGTACTTTAGGAGCGACAGGCGTTCCGGCTGGGCCAAGGCCTCACC
CGTTATCCCGCACATTGACCACCTCATCATCAAACTCGAGCTTACCGGACGACTCACCAACACATTTTCCAGTCCAGCCT
CCTCCCGAACGGAGCCGGCCAACGTCTATATTTACTCGGTCTCTGCCCCTGAACGCTCACAGGCCACGGCAGGAGTCTGT
GTCCACCCCACAGTACAAACTGGCACGTCCGCTACAGTCTGTATTCGCCTCTGCAGGCCTGGTCTCGAAGATGAACCGCA
GTGCGGAAGACGACGCGCCCCAGCCCCTGGGTGGTCGGCCAATGATCATGCCAGATACACCGTGCAAGAAGCAGGTGTAT
CCTTCCAATACGTACCCCCCTTCTTCTGGCAGCGGAAGCCGCAAACGGCAGAGCCAGCGCCGGTTTTTCTTTTCAGCATC
GACTGGAGCAGCGACTGATACGCCGTTCAGCTTGACAAAGCCACGGGAAGCCTCGGCGGACGACACAAACGAGAATGTCG
TCAACTTCTTCAAGCTCAGAACTAGTCATGCTCGAAGGGGCAGTATCCTCAGTATCGACGGCGATATTAGCGACAGCCAA
GGGGCTGCCGACGCCTTCGATCTACCGCCGACGCCTACGAAGTCGGTTCTCACCAGGAACATTTTCGGCAGCGCAAGCAA
GGACCGCGATCGGCCATTTGCCAGTCGCAGTCTCAACTCGTCGATTTTCACACCTGTCGCTCACGACCCGATCAGCATTG
CGAACCGGCAAACCTCTACTCCCCGTGGTGAGTTCTTGCGTAGTGCGCTTGCCTGTCTTCGTACAATGATCGTGCGCTGA
CCCGAGTTTCGTTACTTTAGAGAGCCCATGTAGCAGCTTCAGCTCCGGGAGAATGTCGCCTAAAACGCCCCGTGAGAGCA
GCATCTTCCACAATCCGGATTTTGCTAGCAACATGGCGCCTCCTGACCCGAGCCGCCTATCAATCTCGAATACGGCCAAA
GACACGTTCCCCAACCCGTCTACGTCTACCCGGCTGAGCCCGGCAACGTTCCCGCCAGCAACACCTACAGCTGACCGAGA
GGCTTTTGCGCACTTTGTGGACCGTCGTGTTAGCATCACTCCCGTTCACGGCCACGGTTCAGCGCCGAACGATGCAGATG
CCGTACTCACCCATATGTTTGGCAAGGTGGACTTGGTTGGCAAAGGCGAATTCTCCCAAGTCTTCCGGGTCACCTCGCGT
CAAGATTCTGACAATACGCCGATGGGCTTCGTCAATGCAACACCTACCAAGCGGGCAAGCACAATCACACACAGTGCCTC
GCTGTCAGCCGGCAAATTCTTTGCGGTAAAGAAGATACGACTTCCGTTTTTTGGACAGAAAGAACGCCAAGCAAAGCTGC
GTGAAGTAGCCGCCCTCGAGGCAGTTCGCGACCAGGAAAACGTTCTTCAGATCTTCGACCATTGGGAACAAAATGGCCAC
CTCTACATTCAAACAGAATTCTGTGAGGAGGGCGGCATGGACAATTTTTTGAAAAAGGTCGGCGAGAACGGCCGTCTGGA
CGATTTCCGTATCTGGAAGATTCTGTTGGAGATTTCTCAGGTATGTCGGCCATGATCTACTAAGCGACTCAGGAATGTAG
CTAATATCAAACAGGGGCTGCGATACGTCCACGACGCTGGCTACATCCACCTTGACCTGAAACCGGCCAACATTCTCGTT
ACGTACGAAGGGCACCTGAAGATTGGCGACTTTGGGCTGGCGACAGAGTGGCCTGCACCGAAGGGCATCGAAGGCGAGGG
AGACCGCGAGTACATTGGACCAGAGATTCTGCAAGGCAAATATGACAAGCCATCAGACATCTTCTCGCTGGGCTTGATCG
TGATGGAGATTGCCTGCAACGTCTTCCTACCAGACAACGGCCCTGTCTGGGTAGCTCTGAGAGAAGGGGACATGTCCGTG
GTTCCAAGTCTCACAGCGGGCGAGGCTAATGCGTTGGCCCGAGACTCGGCTGGCATGCCGATTATCGACGACGATGGCCT
CTCCCAAGATGTGTTTAATTTGAGGGACAGCCTTGACCTCGCATCAGCAGACGAGTCTCCTTCGAGGCCGTTTGATTTCG
GCCGGCCGAGATTCGCATCTGGCAGCATTTTCGGCCGTCAGCCGCCAAAAGTGATCGGAGCCGAGCACCCACCAGACTTT
ATGGTGGATCAGCACAGCTCTGGCTCGCTCGACTCGGTCGTGTCCTGGCTTATCAACCCAGACCCGGCAAGCCGCCCAAC
GGTGCATCAGGTTCTGGAAATCGACTCGCTCCGCTGGGTTCACGCGCGACGACGGGCACCGGCAACAATTTTCGAAGGAA
ACTGGGGCCCTGAGAGCGACGAGACAAGTGCAGCGCCGATCGGAGCGGATACCGAGATGATGGACGTTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62