GenePrediction:GLEAN_1858 Details

Name: GLEAN_1858
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1584258..1586010 (+ strand)
Length: 1753
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1584258..1584483 (+ strand)
Length: 226
Type: CDS
Source: GLEAN
Position: GCSC_144:1584581..1584870 (+ strand)
Length: 290
Type: CDS
Source: GLEAN
Position: GCSC_144:1584936..1585047 (+ strand)
Length: 112
Type: CDS
Source: GLEAN
Position: GCSC_144:1585100..1585689 (+ strand)
Length: 590
Type: CDS
Source: GLEAN
Position: GCSC_144:1585837..1586010 (+ strand)
Length: 174
>GLEAN_1858 class=GenePrediction position=GCSC_144:1584258..1586010 (+ strand)
ATGCCCGACATCAACCCGGCGGACCTCAGCCGCCCGTCCATCGGCCTCTCGACCCCCATCCTCGCCAACAAATCCATCAC
CGTCTCGGCCTCGTCCTTGAAGCCCAAGACCAGCCAGATCATCCCTCCGCGCATCGAGCTCGAGCCTGCCTACACAGCCC
TCAAGGCCGCCGTTGGCTCGGACCACTGGAAGGCCTATAAAGATGCCACCACCCAGTTCCTCATCGGTATGCGTGCCCGG
CCAATTGCTGCTGGCCTGTCTGTCCGCTCATTTTCCCTGACCCCTGCGACTAATCAGCTGCTGCTTCCCTTGCCCTCCTA
CAGGCCGCCTCAACCAGGCTGAATACGCCGCCATCATCGACCCCATACTCATGTCGCCCAATGGAGACAAGGAGCATCTT
CATAACCAGCTGGTCGCCGCTATCTATGGCAATGTCACGCGCGAGATGCCCGACATGGGCCTGGCCCCGTGGGTCAGCGC
CAACGATAAGCCTTCGGGCGGGCTTGGCGGCAAGCCGGCCAGCGGCGATGCCAAGGAGCGCCGCCTGAAGGGCGAGATCA
TGCTGCTGCCAAATAAGGACCGGAGGCGCATCAAGGATCTAGTGCACAACGATGTATGCTTACGCACCCCACCTCTGGTC
GATCCACTCGCTCGTACCCAGCTAACATGCAGCCCCAGTTCGATCCCTACGATGCTCTATCGAGCGTGTTCACAGACCAG
CACCGGTCAAGACCGCTTCGCATTGTTGCCGATGTGCCAAATAGTGCTGGTGGCGGCATCAATAGGATGAGTATGTGGTT
CGTTTGTGTAGCCTGCAGACGACTGTCTGACACCTGTTCCAGACCTAGACCTCGAGATCAAGAAACGATACGCTCAACCG
CTGGCCGTCGAGTCGGGCGAGTTTCCCGACACCAGCAACATAGAATCGCGCATGTTGCCTTTTTGTTACGAGGCAGGCCT
GGTGTCCGGCTATGCCCCAGACGCGGCGCAGTTTATGTGCATCGCCACCGAGACATTCATCAAGGAGGCGCTTTCGGCCA
TCTTCAGCCGCACGCGCAGCAACGGGCCCGGCGAGCTGGGCAGCGCTGGCTTTGGCGGCAACAACTGGGTGCAGACGCGC
AAGTACCGGCGACAGCTGACCCGTGAAGAAGAGAGCGCCATGCGCGGCGAGACCCAGCGAGACAAGATGGGGCTGCTGCC
AGTCGAGGCCAAGGCGGCTGGCGAACGCGGACCGCTGGGCCTGGCCGAGCTGCGCATTGCCCTAGAGATGGGCGACTGTG
GTCTGACGCAGTTCCCCGTCATCGGCCACTCGCTCATGTACAACTACCACGAGGGCGAGCTGGAGAACTGGGACGACTAT
ACCTGGATCGACGGCGGCCAGGACCACGAGCCGGCCTCAATGGCCAACGGCACAGCAGGCGCACAGCAGGCCGTAAATGG
CACGGGACCGCTGGTCACAAGCACAATAACAACAGCAGCCGCAGCAGCTGCTGCTGCAACAGCATTGGGGACAGCAGATG
TGGCAGCAGCTGGAGTCGCTGCCGTCGGCGGGCCTGGGGCTGCTGCTGTCCCGATCAAGGGCAGCGCTGCCGGAAGCGAC
GTGCTGATCAAGACTGGCGGCAGCCTGACTAACGGAGCCGAGTTCGCCGACTTCATGGACGTCGACAGCACCGAGATGTG
GTGGGAAGGCGCCGACACGTTTGACGGCGACCTGCTTAACGGCGTGCTCGACTCCTGTCTCGCGGTGGGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62