GenePrediction:GLEAN_1859 Details

Name: GLEAN_1859
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1587101..1591489 (+ strand)
Length: 4389
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1587101..1590372 (+ strand)
Length: 3272
Type: CDS
Source: GLEAN
Position: GCSC_144:1590442..1591489 (+ strand)
Length: 1048
>GLEAN_1859 class=GenePrediction position=GCSC_144:1587101..1591489 (+ strand)
ATGGCCTATTTGTCGAGGACGCCATCGCCGGCGGCGTCTGCTTCTGACTCGGACTCGGTCGTGGCCACACCAATGACACC
TCGTTCCAAGCTTCGGGCTCTTTATGCTACCATTGACGGTAGTGACAGTGATTCCGACAAAGAAGCAGGGGGCGACAAAA
ACAACGGTGTCGGCGGAGAAAATACCACACCCACTCGGAAGGCCAATACCAAGATCGTCAAGCCAAACAATGCAACATCC
CCTGGATCAGGCACCCCGACAGTGCCTAGTAGCCTCGCAGAAGCAGATGCAGCTGTACTGGGAGCATCGTCGCCTGGCGT
TCGACACGCTCTTAGCAAAGTCAGCATAGACAGCGACGATGACGACACGGACTCGCCTGTTGGGCCACGAGGCCGCTTTG
CAGCCCGTATGCTGGATGAGTCGGCTGAACAGACAGAAGCACCGCTGGCGGACAACGCGCGTGAGCGAGTCAAGCGAATG
CTCGAGCAAGCTGCGCAGGCCGAGAAGCAAGCGTCCGTCGAGACCGATGGCGATGATAACGGAAACGACGCCGAGGACGA
GGACGAGGACGGTATCAGCGCCGTTGCCCGTCCGCGGAAGCTGCTAAACAGAGCAGCGCGCCGAAGTACATCGCGCGAGG
CATCCCCCGCAATGTTCATGTCACCGACAAAGCCAGTAGACCGGGAAGATTCACCGGACATGTTTGTTACACCGACAAAA
GGAGGTGCTGCTCCCTTTGATGAGGCCACCTCTTCAGCAACCAACCCAGGTCGCACTGCCCGCTTTCAGGCTCTTGTGGC
GAGGAAGCGTGAAGAGACACGCAAGCGCGAGGAGGAAGAGCAACGCAAGAGGGCCGCCCGGGCCGTCCGACAAGCAGCGG
CTGAGGAGAACGACAACGAAGATGACGACATGCTGATGCGTGACGACGCAGACGATGCCGTATCTGATATCACGGATGAT
GAAGGAGGCCGGAGGCTGACTCAAGATGCCCGGCCGACACGAAAGGCAAGTCGGAAGGCGTTGGAGGAAATGCACCGAGA
GACACAACGCATGGCCCGCAACCTGCAGCTGGCCCACGAGGCAAAGACGAAGAAGAAGATCACAAAGGCCTCGCTGTTTG
AGCGCTTTAACTTCAAGCCAGGAGGTGCGGCCACAGCAACACCAGCAACGCCAGCAGCGCCAGCCGCACCAATAGCACCA
GCCGCTGCAGCCACGCCCATATCCTCCAGCCGGCCAACTTCTCCAACATCTCCTCAAAAGGACCAGGATGCCAACGACAC
CGACACTCCTCCCAGCTCACCTCCTGTAGCCTTGGACGGCGATTCTGTGTCGAAGTCAGCCACGGCGGTTGCTGAGTCTG
ACAAGGGCAAAGGAAAAGCAGTTGCCACGGAAGAGACGACTGAGGCCAAACCAAAACGGCAGATTCGGGTCAGACTACCT
ATCCATACCCACACCGCCCTGCTTGACTCCGACTCCGACGAGCTGGAGATTGTTCAGTCAACGAAGAACAGACTGGATAT
TCTTTTCCATACCGCGCCTCTGAAGCGAGAGAAGGAGCCTCGGTCCATGCTAGCGCTGCGTCGTCTTGCTCAGATTGGCT
CTCCCGATAAGAAGCGGAAGCAGAAGGAGACAAACGACCTGACGTTGGGTGAATTGCAGCAAGTTCTACAAGGCCGAGCG
CGGCATCAGGCGAAGGTCGAGCGTGATGAGCGAATGGAGAAGCTCCGCGCCAAGGGCATTCGCATCCAGACAGAGGAGGA
GCGCGAAAAGGAGATGGCCGAGGTCGATGACATTGTTGCACGTGCCCGTCTGGAAGCGGAAGAGATCATGCAGCGAGAGA
AGAAGGCGGCCAAACAAGCCAAGAAGGAGGGAAAAGGAGGTACCGACGACGACGAAAGCGAAGCCGATCTACTCGATTGG
GACGGCAGCGAAGACGAGGATGGCGAGGACTTTGCCCCCGAGGAGGAGAAAGATTTAGAGCTTTCTGGCTCAGAGGATGA
AGATAATGAAGAAGATGCCGATGCCATGGATGAGACTATGGAAGGGGTGCTGATCGACGATGATGCAGCAGAATCGGTAG
ATGAGGCTGCAGAGAAGACTAAGGACGACAAACCTGAGGACACCCGTCACTCTCCCGATGAGAGTCGCGATGCGCCCGAA
GTGCTTCCCACCCCAAGACGTACTCGTCCCGCAAATCGACGCAATGCGGTGCTGACTTCAGACGACGAGGATGAGGATGT
TGCTTCCTCGCCCGGTCTTCCTGTGTTGACGGAGGCGAATACGCCAAGGCCCAAGACCGCCTTTGCCAAATCGCCGTCGG
GACCAAACATCAACAGTGATTCGCCTCACGTGCCAACGTCGGTTTTACGGTCCGCGACCAAGAGCTTCATCCCAGGCTTG
CCCGTAGCTCTTGGTGGGCCTGCCGGTATGGGCCTGACGCAGATCTTCGCCGGCACGATGGCGGACGACAGCCAATTCGC
GGGCTCTGCAGGTGGTTTCGGCTCCCCATCACAGCTCATGCCGACTATTGGCAACGTTTTTGCAGGGCCGAGTCTAGATG
GAGCCAAAGGCAGCACCGACGACCAGGATTTTGTGCACAGCAGTCAGCCAACCCAGGATTGGGTCAGACAAGTTCAGGAA
GGTGGCTATACAGGTAGCCAGGCCGTCAAGCTGGACTTTAGCCAGTCACAAGTCCATGGCCTGGGCAGTCTCCTTCATGA
CGTCGACTCGAGCCAATTCTCCGATCTGATGGAGAGTCAGGATCTGCCTTCTCAAGAGTACACGCCGCTGAAGGTGCGCT
TTATCGAGCATCAAGCATCTACAGCTGAGACGGTTGTCATGTCACGGTCAGAGAGGATGAGTCTAGACGTGTCGCAGCCC
CAACTAGAATCTATCGCGCAGTCGCCATCACCTCCGCGGAGAAAGGGCAAGCTTTTCCGCAAAACGATTGCAACAGAGGC
CGACGCCAACGAGGAAGAGGCAACAAGCGACATCGAGGTGACTGCAAAAGCCAAGTCGGCATTCAGTATGCTAAAAGACG
CCTCGGCAGCCAAGAGGAAGCAGGCGTTAGCAACAGCCTTTGACCGAAAGAAGAGCAAGGCCAAGGAATTAGTTGAGGAG
CAGGCTGAAGAGTCTGAGGATGAATATGCTGGTCTTGGTGGTGCAGATGGCGAGGACAGCGACAACGAGTCACTAGCTTC
AGTGAAAGACCTCATCGACGACAACCAAAAAGTGACAGAGGCAGAGAGTGCGAAGCTGGCTGCTTTCTATGCGTGAGTTT
TGCCCTCTTTCTGTGGACTGTCTCAACCGGTGACGTATTCACTAACCTTTCTGTCTGGCAGTGATCGGGAGCGTGAGAAC
GACGAAAAGCAGGTGGAGAAGCTTTTCCGCGATGTCACAACGGGAATGTTGCGGCGTAAACGTGGTGCAGACTACGATTT
GTCGGACTCGGATGACGATGGTGAGGCACGTCGGCGGATGAAGCGGCGGCAATTCGCACGGATGCAAAAAGCGCTGTTTT
CCGATGAGCGGATATCAAAGGTAGCGGAGAACCCACGGAACCTGGCGTTCCTGAAGACGATCGAAGACCGTGGTAGTGAT
GATGAGATGGACTTTATATTCGACAACGCTGCATCGACAGTCACGTCGACCACGACTTCTACAACTTCTACAACTGCAGC
TGCTGCCGATAGTGATGGCCCCAAGGTTGTAATCCCGGACAGTCAGCCAAGTATCGAGCCAGAGAGTCTTTCAGACAGAC
GAGCAAAGCGGCGACAACAATCTGGCAGCGGCAAAAACGGCAAAAAGCCATCCAATCTGGGAGAGATTCGCGAGTCGCTT
TCCAACCTTCTGGAGGACGAGACGAGCATGTCGGTGGTGGCAGACAAGGAGTTTGGATCTGACGAAGAGGATGACGGTAT
TCATGGAGCCACCAAGGAGAGCCGGCGGGAGGACTCGGAGCAGCGGCGGAACAATGCCAATGTAGTGGATCGCATCAGCC
TGCAACGGGCCAACAGTAGCACACATGCGACAGCTGGCCGCACTGCTTTTGATGCTAGCCTTGGTGGAAGTCCGATGGGC
CCGACGGGCTTCAAGGCACCGGCACTGCTGCGACGGGCAACCACCAACTCGCTGTTGTCTGCTACGAGCAGTCGAAGCAG
CAGCAGCGGTGGTGGTGGTGGTGATGGAAACGGTGGCGGCTTTGCCGATCAGGGCAAGATCAAGAAGAATGCCAGCAAGC
AGTCTGGCATCAACTACTTTGCACGGGAGAATGAGCGGCGGACTGCCATGGCAGAGAGCGACAAGCGGCGACAAGCGAAG
AAGGTGCGCAGTGCAGAGGGCCGCAGTCGGATTGTCGGCGGGCTATTCGGTGCCGGCAAGTTTGAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62