GenePrediction:GLEAN_185 Details

Name: GLEAN_185
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:67327..76006 (+ strand)
Length: 8680
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:67327..67343 (+ strand)
Length: 17
Type: CDS
Source: GLEAN
Position: GCSC_167:67709..71754 (+ strand)
Length: 4046
Type: CDS
Source: GLEAN
Position: GCSC_167:72242..73665 (+ strand)
Length: 1424
Type: CDS
Source: GLEAN
Position: GCSC_167:74010..74116 (+ strand)
Length: 107
Type: CDS
Source: GLEAN
Position: GCSC_167:74189..74227 (+ strand)
Length: 39
Type: CDS
Source: GLEAN
Position: GCSC_167:74975..75510 (+ strand)
Length: 536
Type: CDS
Source: GLEAN
Position: GCSC_167:75579..76006 (+ strand)
Length: 428
>GLEAN_185 class=GenePrediction position=GCSC_167:67327..76006 (+ strand)
ATGTCTGGACGCGGCAGGTAAAACGCCCTGATGATATCTGTTGCCGAGTGGCTATTAATCGTTTGTATCACAGAGGCCCT
AGTGGCCGTACCTGGGGACACGGATCAAGCCCGCGAACCAACGTCTGCCATCTTTTTCTATCCAGCGGCCGGTGCCGTTT
TGGAAATAACTGCAAATACTCCCACGACACAACTTCATCTTCTGCTCCTACCTCATCATCTCCGACGAAAGCTCGTCAGG
AAAACGTCAACCCTGTGGATGATGGACGTCTTCCACAGTACAAAAGATTGCTGAAACAGAGAGGTAGGGAATACATTCTC
CGGCCAGATGCTGCCTCCGTTGGTCGATTTTTCTCTCTGGGTTGTGACATTCTGGAAAACAGTGAAGATGCCGGTGCCAA
GCAAGAGGCGATCAAACTGTTGGCCACAGAGGAAGGCTTCCGCTACATCCGTGATGTCGTTGATACGCACATCCCTGAGG
CTATGGCCTGTGGGATCACCCAAAAGGCCGCTCTGTGGGAGAGCGAAGTCAGTCCTCTCTTCCTGTTTGTGACGCACAAA
AGCGTCACGGGCTCCGCCTTTCTCGAAGAGCAGGTTGCAAGCATATATAACTTTCTCGTTGGCGTGGGTGGAAAACGCAT
GAATGCGCTGTTCAACTTCGTCATTGTTCTCGCCAAGGATCCCAACAGACCAACGCCTCCGACCAACATGGTTCTCGTTG
AGTTAAGTCTGGCAGTGCTGGCCCAAATGATCTCATCCAATACAACAAACATGGCAAACGACGACTTCCGTGTTTTTGTA
GACGAGCTGGCCACACTGGCCACGGCTGGCAATGCCGTTCTTAGAGACGAGCTTTCTCAACGGCGAACCAACACGTATGC
GAGCTACATCCGCAGACGCCTGCAGGTCGGCGATAATCTCCCAGACTTCCAGCCGAACTTGGTAGCTGCTTCTGTGGGAC
CTGTGCCCTCGTTCCGGTTTCGAAGTGACTTTCCAGGACACTTGTCCGCTGATGGGAGGCGGCATGGCAATGACTACGCC
GACATCGCGCGTATCTCCATCATGCCAACATATGAAGAAATCATGTGCGACCGTTCTGAGTACCTCCCTGTCACAGACCC
GGAACAGTGGCACCGGCAGGGAATTTCTGGTCGCCTAGATCGTGAGTTTCGACTGCTGCGGGAGGACACCGTGGGCCAGC
TTCGGGATGTCGTTCGAATGGAGCTGGACAACCTCATTCGGCTTGAGAAGGAAAAGACTGCCCCTGGCCAGACCAAGCAA
CGTGCGCATGCAGCTTCAGGGAAAGACAATATTCGATATTGCACGTACCAAGATGCCAATATTATCAGGTTGGACTTTGA
ACGTCGCACAGGATTGGAGTTTGTCGTCCGTTTTCAGCAGCCGGCCCCCAGTCATGTCTCCGCTGGCGGCTCGAACGGCT
TGGGTGGCAAGGCAGCCCAGCTCCATAAGCGCCGCATTGAGTGGTGGACACGGGCAAAGAAGCGATTGCAACCGGGCGGC
CTGCTGTGCGCCATTGACTTTCGCGGCTCGGTACTTTTCTTCACAGTGGCCCACTCGACACTCCGGACGCTTCAGGATGC
TGGTCACCGGAAGAAAGATGGAAAGGAAAATACGGAAGAGGAGAAAGTCAAACCTGTGACGCTGGCAGACGATGCCTTGC
ATTCCTATGTCAGACTGAACTTGGTGGGCGCCGACAAAATGGACCATGTCAAGGAAGCCCTCAAATGGTTCTTGCAAAGC
AAGACAAACACTAGTGGCGGCAGCCTTTGGCATCAGCAGCGAGTCTTGGTGGAGTTTCCGGGAATCCTGCTCGATGCTTT
CCAGCACACGTTAAGGGCCCTACAGACCGCCTCGCAAAAAATGGACGTGCCGTTTGCTGATCTCATTGCCCCCACGAAAA
CACTTGACGGTGTAGTAGGTAATGGGATTGCTGATGTGCCGCCGCCAATATACGCCCAGAAACCTGGATTTGTCTTCGAC
CTGGGATGCCTGCGAAACGTCGGTAGCAATGAGATATTGCAGCACAGCATCCAGAAAGCGCTGGAACCAGAGAAACTAGA
AGCCAATTCCTGTCTGGACAGAACCCAGTCGAAAGCTCTGACACAGACCCTCTCGAGAAGCATGGCCCTCATCCAGGGAC
CGCCTGGGACGGGGAAGACATATGTGGGTGTCGAGATCATCAAGGTGCTCCTTGGCAACAAAAAATCGGCAAAGCTGGGC
CCCATACTGTGTGTGTGTTATACCAACCATGCGTTGGACCAGCTGCTCGAGCACCTTCTCGACTACAGCGGTACCGGCCA
GATTATCCGCATGGGTTCGGGCTCCAAGTCCGAGAGGCTGAAAAACCGGGGTCTGCGAGACGTCGCCGGCAAGATCACCC
GGACACGAGAGGAGAGGAAATCTATGTGGGCAAGGGGAACCGATCTGGACTCGTCAACGGAAGAGCTGCAGGAATTGTCC
CAGCGCATAAGCCGGGCGCTCCCGTTGGCAGAGATAGTGCGCTTCTTGTGGGAAAACCATATGGCGCACTATAAACAGCT
ATTTCGCACAAACGTCCTCCTTATGGGACATGGCAAAAATGCCATCGGTGCCAAGGATGAGGACGGATATCGGACCGTGC
TGGGGAAGCCAGATCAGAAAATCAGGGAATGGCTTGGCGGCGGAAAGCGAGAGGATGGCCGCAGGAACCCCAGACGCAAG
CCAGAGGACCTCGAAGAGGCCGACCTCCACACACTGACACACAGAGAGCGACATGACCTCTACAAATGGTGGGAAAAGTG
CAGTTTTCAAGAGGTCACAGACGAGATTGTCAAACAGAATGGCGTGTATGCGGTTGCGAAGCGGTCCTTCGACTTGGCGT
GTCGTGAGGTCGACCTGAGATGTCTCAACGAGGCGGATGTGATCGGCGTGACAACGACTGGGCTAGCACGAAACATAGAG
CTGCTGCGGCACTTGTCTAGCAAGGTGTTGTTCTGCGAAGAGGCCGGAGAGGTGTTGGAGGCCCATGTGCTCACATCTCT
GCTACCGTCCATCGAGCACGCGATCCTTATTGGCGACCACCAGCAGCTGCGGCCTCAGGTGCAGAATTATGAGCTTCGGA
GCGACAATCCACGCGGACAGCAGTTCTCCTTTGACATGTCGCTATTTGAACGTCTTGTGGTGCCACAGCACTCTAGCGAG
CTACAGCTTCCGCTGAGTCAGCTGGCAACACAGCGCCGCATGCACCCGTCGATCTCGGCACTGATCCGCGCCCCATTGTA
TCCAGAACTGGAGGATGGTGAAAGTGTTGGACAATACCCAGAGATTCCAGGCCTGGTGCGGCGGCTTTTCTGGCTACGGC
ACTGCCAGCCTGAGCTCGGAGCTGCAGATGGACCGCAGGCTGATCCCACGACTGCTTCGCGCACGAACAGCTTCGAAGTC
GAGATGACTGCGGCCCTCGTGTCGCACATCGCAAAGCAAGGAGTCTATGCCAGCGGAGACATTGCCGTGTTGACGCCGTA
CCTAGGGCAGATGCAGCTGCTGCAACGACGCCTGGCGTCCATGTTCGAGATTAGCTTCAACGACCGCGACTTGGAGGAGC
TGGAGGCCGCGGAGGCCATTGACGGTGCCGCTGACGAGACAACGGATATCACAAGGGCCACAGCTGCCTCCTCTAGTCTG
AGGCGTGGCCCACAACCGGCAAGGACGACTCTCCTGCGCAGCGTCCGTGTGGCCACAGTAGACAACTTCCAGGGCGAAGA
GGCCAAGCTGATCATCGTGTCGCTTGTTCGCAGCAATCCACAGCAACGATGCGGGTTCCTCAGCACGGCCAACCGAATCA
ACGTTCTGCTTTCGAGGGCCAAGCATGGCATGGTCATTATCGGAAACAGCGATACCTGTGCCAGAGTTCCCATGTGGAGA
CAGGTGGTAGCGATGCTCGAGGCCAAGGGCAACATCGGCGAAAAGCTTCCACTGTGTTGTCCGCGGCATCCCGAGCGCAC
TTTTGAAGCCTCTAACCCAGACCACTTCTTGCAGTTCTCACCCGACGGCGGCTGTCTCTTGCGGTGTGACAAGCGGCTGT
TCTGTGGGCATGCCTGCACCGGCCGCTGCCACTCGGATATTGTACACCAGGCCGTCGAGTGTTTGGAACCCTGTCCAAGG
CCACTGCGCGGATGCGATCACAACTGCCCACGACCTTGTGGAAAGGAGTGTATTATCCAATGCAACGTCGTGCTCGAAGA
TTCTTTCCTGACACTGCCATGTGGACACCAACGAATAGCACCGAGGTGCTTCGAAATGCAAAGGCCTCAGTCTATCAAAT
GTATGGAGCGCGTCGTTCGTACTGTTCCAGGATGTGGACACACGGTTCAGGTAGCCTGCCACACCAATGTTTCGGAAGAT
GCATTCCCCTGCACGGCCAAGTGCGGCAGTGCGTTGCCGTGTGGCCATAGTTGTGGATCTGGATGCCATGCCTGTCGGAC
ACGCAAAGACGGCGAAATCGTGACGGTGGTCCACGGCATATGCAACACACCCTGCCAGAGGCCATACAGCGCGTGTCAAC
ATGTGTGCAGACAGAACTGCCATGGGGACAAGCCCTGCGGGCCATGTGTCGCGCCATGCGAAGTGCGATGCAGCCATTCG
AAGTGTGATCTGAAATGCAACGAGCCCTGCGTGCCTTGCGCCGAAGGGACCTGCAGCTCGTGTTGTCCACATTCGTCTTG
CACAATGCCGTGAGTGGTGGACCCCTCTGATGTGAACATTCCCGAAAACTGACAGCTAGTGCAGGTGTGCGGCTCCATGT
GACTGGGTGCCTTGTTCGAAGCGCTGTTCGAGGTTGCTTGACTGTGGCCATCAATGTGAGTCCTTCCTTCCTCTCTTTGG
AATCTTTGCTTAAGATCTATATTCTCATTTCACAGGCCCGTCTGTCTGCGGAGAGCGCTGTCCGGGGCAGGAGTTCTGTC
AAGTGTGTGGTCACAAAGACGTTCTCGACCAAGTGGTAGATTTCATCATGATGACGACGTACCGCGACACGGATGTTGAC
GAGGATCCGTGCATTTTCCCGGACTGCGGTCACGTATTGGCAATGTCGTCCATGGACGGCATCATGGACATGACCAAGCA
TTATGCCATGCACGAAGAGAACGGCCAGGTGCATCCGGCGTCCTTGTTGACATCTTCTGCGCCATTTGATATGGCCGAGG
TGAAAGTTTGCCCCAATTGTCGAGGATCCCTGCGCAGTGTGGCACGATATGGGCGCATCGTCCGCCGGGCGCTTCTGGAC
GAATCAACCAAAAAATTTATTGCTTGGGCCAACCAACAACACCAGGTCCTGTTCATGCGATTTCTAGCAGAGAGAGAGCG
CCTGGAAACAGAAGCCCCGTCACGAAACAACAATGAATCATGGAAGTCGGTTGTCTCCAAAGGTCGTGAATCCGGCATCA
GGCGACTTGTCCGTGCAGCAGATGCAACACGATACGCAAAGCTCTCCAAGCTGCGGGATGACATCCGGTGCTATGCAAGG
AAAGTACACATGGGTGAGCAACCGTTTCAGAGGGTGGCAGATTTGGTGCAGTTTGCCCGGCGCAAGCGTCAGGGAGAACA
CGAGGAACAGACGCCCAGGAACAACTTCAATTTTGATGAATCGGTCATCCAAGTGCGCTGCCATATGGTTGCCACGATCC
TGCTTCTGCGCTGCGATATTTTTGCCCTCCAGGATGTTTACGACCTCGTCTGTAAACCGACTCTGAATCAGGCGAGCAAG
GACGCCGTCAGCATTGCCATGCAGAAGATGGTGACAATGGGCGGCACCACAGAGCTTATCAAAGACTGCGAAGCTTCTAT
AACGCTGGCCCAGGGGGCCAAGTGCGTCCGACAAGAAGTCGAGGGGCACATCTGCTTTGCACAACTTTGTCATTTGTTCC
GAAACATGTCCATGTTCGATCCGGCCAGAAAAGACGAGGCGCGGGAAACTATAAAAGAAGCTGGTCTTGCGCATGTGGAA
GATGCCAAGCTGTTGGTCGAAAAGAGCTTATCGGCAAAGTCGCTGGAGCCAGAGCTTGTAGCAGCCGAAAGGGCGTTGTC
CGATGCGCCATTCTACAAGCCTGTGACGACAGCAGAGCTCAAGGCAGTGTACACGGCCATGTCAAGAGAGTTCAGTGGCA
CCGGTCACTGGTACACGTGTGCACAGGGCCACTACTTCACCGTAGGCGAGTGTGGTATGCCGATGGAGCAGACGCGATGC
CCAGAATGTGGATCGCCTGTTGGTGGACGAGACCACACGAGTGTAGAGGGAGTGCGAGCAGCAGATGATGTGGAGAGAAT
TGCGAGGGAATTGAACCAGGTGAGATTAGGCTGATGGCATATGTTTGGAAGCTGTGATTTAGTCGCTGCTTGCGGATGAA
CGGAAAGAAAAAAAGAAGAGGAAGAAAACAAGATTGTGAGCATCTGATTTATGGGCAGAACAAAGGGCAGAAATTTACTT
TCGACGTGCATATTGCTCTTGGCGCTGAAAATGGAAGGAGCTGCCATGAACGAATCAGGAAAGGCATTAGTCACCGCGGC
TGCCGTAGTAGAGAAAAATGTGATTTTTGAAGCAACCTCGTACGAATCTAGCTGACACTGTGTGGTCCCGTGACTTAACG
ACTTCAATCTATCCAGGCTGCTGCCTAAATCGAAATTCTACAGCCCATTGGCATTGCGATGTCTACGTTCGATGGCAATA
TTCGAGAGTTTCCCGACATACAAGGTGCGCAGAAATGGCACTTTCTTCTACGAAAGGTCGCTGACAAGGTGTTAGTCGAT
TACTTTCGCAGCCATGCAGCTGCTCGTCAGCCGCTTGCCTGCTTTCTGAGTCATGTGCACAGTGACCACCTCGTGGGTCT
CGAGACGCTGCGCTCGCCGTTGTTCGTCTTATAGGGGGAGAGTCGGGTATTGTGGCCGCTCTGACTCACCTATCAGCGTA
TATTGCTCGGCCGCAACCAGAGCTCTGGTGCTCCGCCTCGAGAGGTATCCCTGCCGGCTCAACCATGCCAAAGGCATTCT
CGAGGCTAGAAATCGGACTTATGCAGGACTTAAATATCTCCTTGTAAGAATCAAGGGCATGTATGGAAAAAGGCGAGGAA
AGACAAAGGACAGCAATTAATCCCTTCTACAGAAGCCCCTTCCCCTAGAGGCGCCCACGACAATTGAGCTTTCCCCAGGA
AATCGCATCCGCGTGACGCTGCTTGACGCAAATCACTGTCCGGGCTCGGTCATGTTCTGTACGTCATACCTGCTTCTGTC
CCCGACCTAAAGCTGACTAGCCGGTGTTTGAAAATGCAACCAATGCCGTTCTCTACACGGGCGATACCCGCTGTGAGCCC
TGGTTTGTCAATGCGCTTGTGCGAAACCCCTGTTTGGCAGAGTATGCTGCCGGCTTGCGCGTCCTGGATACTGTCTACCT
AGACACTACATTCATCGACAAAAACAGGCCCTTTCCAACAAAGGCAGAGGGACTGGGCGAACTTCTTCGCGCCATTTACC
AGTTTCCTCCCGAGACTGTCTTCCATCTGCGAGCTTGGACTTTTGGGTACGTATTCAGGCACAGAAGTCGCGGTAGGGCA
GCTTCAAGTTCTCATTTTACCGGTAGTTGACTTATGACGTGCACAAAGGTACGAGGATGTCTGGATCGCTCTCGCGAAAG
CGCTGGATTCAAGAGTGCATGTGGATCCGTATAGGATGCAGCTATACCAATCCCTCGCAGTAAAGGAATCAAAGCATCGG
TTCTCTGATGCCATTCCTCTTGCCCCTGAGGCCCCCGGGCTTGTCGGCTTCTTGTGCGCCAACACGGCGCATGAAGGATG
TCTGTCGACCGCTAATGACGCAGGTGTTCATATGCGAATACACAGCTGCGAGAATGGTACCAGCCACTGTTCGGATATGG
GAGACGCGTCGGTAGTGTGGATCCAGCCGATCGTGTCTCGCCTTTCTCACGGCCGTGGTGACTTTATCGAGGCTGCCATG
TGCGATCTGGAGAGACAGCCGAGAAAACAAGCGAGGCGCAGCGAACCAGAAACAATTTCACGGACTATCACGTTCCCGTA
CTCCCGACATTCATCATACCCAGAGCTATGCCATCTTCTCAGCGAGCTGCGTCCAAAGGATGTCTGGCCCTGCACAGTCA
ACCCCGATCGGTGGTTTCAGAGCGGTAATTGCCCTTTTCTCGGATTCCGACGTGTGGTCAGTGCTAATGCTGTGTGCACA
CTGATTTGGTAGGTAGCATTGTGACCATTAAAGATTTATTTGGGGAGTTTTGTTCGGGTGATGTCTTCCGCCATGATGAG
GAGGTCGCTTCAAAGTGGAAACAGGGTCTTAAGATGGTGGTGGATGATAGCCAGGCCACGGCTGATTCGGATTTGTACCC
GCACCTAGATACACTTGAGGCTGATTACGAAAGTGTCTCAGCAGAGGCAGAGCTATTTCGTCCGTGCGACCCCCCCTTCT
TTGCGTACGGGGGAAAAGACGCACAAGGTTCACAAGACTCTCAAAATTCGATGATATCAGAATTCTCTATGGAGAAAAGA
ACACAAGCTCACGATGCCATGCTGATGAATGCGGCAGGTGGCCGAGACTGGAATTGCATCGGCCTCCTTTCTACAAACGA
CCGCCACACTCTTCCTGACGAGGACCTTGGCGTTAGATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62