GenePrediction:GLEAN_1861 Details

Name: GLEAN_1861
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1593931..1595415 (+ strand)
Length: 1485
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1593931..1594305 (+ strand)
Length: 375
Type: CDS
Source: GLEAN
Position: GCSC_144:1594365..1594477 (+ strand)
Length: 113
Type: CDS
Source: GLEAN
Position: GCSC_144:1594548..1595415 (+ strand)
Length: 868
>GLEAN_1861 class=GenePrediction position=GCSC_144:1593931..1595415 (+ strand)
ATGCGCGCTTCTCTCTTGCGGCGACTGGTTGGATTGACAGCGGCATCCCCACGCCGCTGGCTGTGTGGCACGACGACGCC
GTCGTCGCCATCAAACCGGACGGACGTGGAGCCGTTGCGCATCCTCTTCTGCGGTTCTGACGCCTTTAGCTGCGCATCTC
TCGGAGCTCTGCATGCCGAGATGCAGCGACAGGATGGTCTCCCAAAGGACCACCGGGCGTCGCTGGCTGGTCGCATCGCC
TCGCTCGACGTGGTCGTCCGACCGGCCAAACGGACCGGACGCGGACTCAAACAAGTGGCAGACAGCCCGGTTAGAACCAT
GGCCACAGAGCTGGGCCTCTGCGTCCATGAACGGGACACCTTTACCGGCTGGCAGGTATGGACTTTTTTTTTCTCGGCAT
CTCTCCTCTCCTCTCTCCTGACCGGCCGACATAGCCGCCGTCGGTCAACATGATCATCGCCGTCTCCTTTGGCCTCTTTG
TGCCGCCGCGGATCCTCGGTGCAGCCCGCTACGGCGGCCTGAACGTGCATCCGTCGCTCCTGCCAGAGTATGTTAAAGTG
CCTTCTTTCCCCGTCTTTGGCGATCTTGTCTCCCCGATTCTGACAGCGGGCAAACAGTCTACCGGGAGCTGCGCCCATCG
AGCATGCCATCCTGTCCGGTCGCGAACGCACCGGCGTGACTGTGCAGACGCTAGACGACAAGGCCTTTGATGAGGGTCAC
ATCCTCTTGCAGGGACCCAAAGCTGAAGCTGAAGAAGGGGCTTTCGGCCTCGCCATCCCGCCGAGCTGCACCGCGGACGA
GCTGCACCGCCTTCTGGCTCCCTTGGGCGCTGACCTCCTCATACAGGCGCTACGTCGAGGACTGTATCTTCCTGGAGCTG
TTGCTGCTTCGGCTGCAGCCAAAATCCTGCCGCCCGGCTTCGTTCCCGTCCTCGCATCCAAGCTGTCCAAGGCCGACCAG
CAGGTGCCGTGGAGACTGCACCAGCACAGCCAGTCAGCAACAGCAACAGCAGAAGACATTGACAGGCGTGCCCGTGCACT
CGGTCCGCTTTGGACGCACTTGGCGGTGCCGCAAGGCCGACAATCGCCGATGCCCACGCAGAAACGCGCCATTCTAGGCG
ACATCGAGCTGGTCACGTGCCCTGACCAGATGGCACCGCTGCTCCAAAGGCAGGCCGCTGAAAGCAGTCGTGCCGAAACC
AAGGACTCGCCATGCGCATTCCAGACGGCCACTTTTGTCCAGAGAGACGGCCAACACCAGACTGCAGTCGCACTGCCGTT
CACTGTATCCCCCGACGGCAGCGAAAGCATTATTCTTCCTGCTGGCATCTCATCCCGAGCCTCCGACTCTTCCTCTTGCA
TCCGCATCGGCACCATCAAGATCGAAGGCGACCGTGCCAAGCCTGCAGCCCGGGCCATCGCCGGGTTCTCTCACAACGAA
ACAACACTCGGACAAGTTGCCTGGTACGTGGTTTTCCGCCAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62