GenePrediction:GLEAN_1862 Details

Name: GLEAN_1862
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1601583..1602524 (+ strand)
Length: 942
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1601583..1601907 (+ strand)
Length: 325
Type: CDS
Source: GLEAN
Position: GCSC_144:1601965..1602075 (+ strand)
Length: 111
Type: CDS
Source: GLEAN
Position: GCSC_144:1602291..1602409 (+ strand)
Length: 119
Type: CDS
Source: GLEAN
Position: GCSC_144:1602468..1602524 (+ strand)
Length: 57
>GLEAN_1862 class=GenePrediction position=GCSC_144:1601583..1602524 (+ strand)
ATGTCCAAGACGTATGTCGTCGAGCACCTGGACGAGGGCATGGGGGCCTGGTCGACGCTCGAGTACGTGACGATTGCGCG
CGAGACTGGCGCGCTGTGCCTGTCGTCGCTGCCGCCTTCGCTGATGCTGCCGGCCGAGCTGACGGCCGTGGCCGGATTCC
GGGCCGAACAGCGAAGCGTGGAAGAGCTGTATGGCGGCGATGCGGCGCAGAAGGCGCGTGTGTGTCTGCTGGACCCGGCA
GCGGCGCAGGAGCTGGTGCCGGCGGACGGTGACGTGTTTGATGTCTTTCTGTTTGGTGGGATCCTGGGCGACGATCCCCC
TCGGGGTGAGTAGCGATGTCTGGATGTCTCAGTCCCTTCACAGCCCAAGCTGATCATGGCAGATCGCACGTCGGAACTAC
GCAAGAAGGGCTTCCAAGGCCGGCGACTTGGGCCCAAGCAGATGACAACCGACACGGCCGTGCGAGTGACTCGGATTGTG
ACCGAACAGAAAGGTGCGTTGTTTGTCTCTTGTCTTTCGTCTCTTCTTTCTTCTTCTTTCTTCTTTCTTTCTCCTTTCTT
TTTTTCTTTTTTTCTTTTTTCTTCTTTCTTTTTTCTTCTTTCTTTTTTCTTCTTTCTTCCTTCTTCTTCCTTCCTCTTCC
TTCTTTCTTTTTCTTAACTCTCCCCTCTACTCCCATCTCTCCCTCGTCTAACCCCCCCTAAACTCTAGTCCCGCTCGACC
AAATTTCCTACGTCGACTTCCCCGAGCTCAGGTTTGACGAGCACGAGAGCGCACTGATGCCCTTTCGCTACGTCAAGGGC
GACGACGACAAACCCATCATGCCCGAGGTACGTTGTTTTCTCTCGACAGCCAACTGCCAAAAGCTCCTGCTAACCCGTCT
TCCAGGGCATGCCCGAACTGATCAAGAAGGATGCCGACAATGCAATCGACGACCTATTTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62