GenePrediction:GLEAN_1864 Details

Name: GLEAN_1864
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1604149..1606101 (+ strand)
Length: 1953
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1604149..1604802 (+ strand)
Length: 654
Type: CDS
Source: GLEAN
Position: GCSC_144:1604858..1605013 (+ strand)
Length: 156
Type: CDS
Source: GLEAN
Position: GCSC_144:1605070..1606101 (+ strand)
Length: 1032
>GLEAN_1864 class=GenePrediction position=GCSC_144:1604149..1606101 (+ strand)
ATGGTCACGGCGCCTGAGTTCGGCTCTGCCGAAGCCCGCAATGTTCGCGAAACAGACGCTCTGTTGCCGGCAGTCGGGCG
CAGCAGTCTGGCCAACGGTGACCACGGCAACAACGACAACTGCGATGACAGCGGCGACTGCGACACCATATCCGACAATG
CAACTGTCACACATATTGGCCCCAGTCGTGCTGCTGCCATTGCCGTCAACATGGGCGTCCTCCTCTTTCTGCAGGCCAGC
AATACGAGCGGCATGACCATGGCCCAGTCCGCCATCGCCGACGACCTCGACGCATATGAGCACGCCATGTGGTTCTCCAG
CGCCTACCTCATCTCCGTCGCCTCCTTTGCGCCGCTGGTCGGCCGTCTCGCCACCATCTTTCCTGCCGGCCATTTGTTGC
TCGGTGCTGGTATCTGCTTTGCTGCCGGAGCCCTCATCACTGCTTACGCCAATTCCCTGTCCGTCTTTCTGCTCGGCCGC
GTCATTATCGGCATCGGTGGCGCTGGCGTCATGACCCTGTCGCTCATCTTGGTCCTCCAGCTCGCCGATCGCCGTCGTCG
AGGTCTCTTTGTCGGCATGGTCAACGCAGCCTTCACCGTTGGTCTGTCTGCTGGGGCCATTGTGTATGGTGCCCTTCTCC
CCATCATGAGCTGGGTAAGCTCGTTCTGTCCCCGCTTGTTCTCTGCGCTGAGCTGATATTGTTTTGCAGCGTACCTTGTT
TCTCGTCCAGGCGCCCATGGCTCTGATTGCCGGTGTCTTGGTCTTCTTCAGCTTGCCGCACCTCTCCCAGCATCAACCGG
ATGGGAAAGGCCGCTCTGTCTGGTACAGGCTGGCTCGCATCGATTATGCCGGCGCCTTCTTCCTGGTCAGCTTCTTTCCT
TCTTCCTTCGTCGCCTGCTATCCGTCGTGCTGACCGCCCAGACCCTCACCATCGTCCTCCTACTGTACTCCCTGTCCGGC
ACCTGGCGTCCGCTGGCGATGCTTGCATCTGTTACCAGTCTTGTATGCTTTGTTGCCATCGAGTACTGGCTTGTGCCAAA
CGTCTCCGGTGGCGATCCCATCATCCCGCTCGAGCTGCTGCGTTCCCGCGGCGTCCTGTTTTCCTGCCTCGCGCAACTCG
GTGTCATGGCTTCTCGCTGGTCTGTCTTGTACTATGCTCCCATTTTTGTCTTGACCGTCCAAGGTCAGTCGGCTGCCGTC
GCCGGCGCTGCCCTCATTCCAACAAATGTCGGCTTTGGCACCGGTGGTCTGCTTGTCGGATGGCTCCATATCCGTCGCGC
TGGTGACTTCTGGCTGCCGAGCGTCGTCTCCATATTCCTGTTCTGTTGCTCGCTCGCTGCCGTCGGTCTGCTTAGCCGTG
CATCCGATTCTTTCAGCGCCGGTTGGTATATGCTCTCTCTCTTCACCAATGGTTTTTGCACCGGCGCATTTCTCAACTAT
ACCTTGGCCCATCTTCTGCATCTGACCCGCCCTTCCACCCATTTCGTTGCGACAAGCTTGTTGGCCACCTTCCGTGGGTT
CTCTGGAAGCTTTGGCACCTCCATTGGCGGCGGCTTCTTCATGCAACAACTGGGTGTCCAGCTGGCCACAGGTTTCACTG
AGCTAGATGGTGGTAACCTGACTGACGCTCATACTGCCATGATTTCTCGCCTGATAGGAAGCCCGGCTCTGGTGCATGGC
TCGGATGGAAACGGACGTCCTGTGCTAACCAATGCCGAACGCCAAGTTGCTATCGCCGGTTATGCTGCTTCGCTGGGCAC
TTTATACCACGCTGCTGCTATTGTTGGTCTGCTGATGCTAGTAGTCCAGGCATGCACTGGTTGGGCCGAGCCAAAATCAC
GCGCCTCCACAGAAGGCGGTGGCCTCCAACAGGGTGCCAAAGATGACGAAGAAGAAGATGAGGAGGAGATCCTTGAGGCC
ATTGCTGAGCATAATGGTGCCATGGAAGCCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62