GenePrediction:GLEAN_186 Details

Name: GLEAN_186
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:98977..100845 (+ strand)
Length: 1869
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:98977..99062 (+ strand)
Length: 86
Type: CDS
Source: GLEAN
Position: GCSC_167:99135..99205 (+ strand)
Length: 71
Type: CDS
Source: GLEAN
Position: GCSC_167:99295..99375 (+ strand)
Length: 81
Type: CDS
Source: GLEAN
Position: GCSC_167:99461..100845 (+ strand)
Length: 1385
>GLEAN_186 class=GenePrediction position=GCSC_167:98977..100845 (+ strand)
ATGAGCGAGAACTTCCATCCTTACTCGACTTTTGGGGATCACACTATTCCGCACCTTCCAGTGGCTCCAATCAAGATTGA
AGATAGGTGAGCATGCAAAAGGCCAATTTCCCTCATAATGCCTGCATACAGGAGCTGATCATCGTACCCTCATTAAAGCG
TTCCAGACTATATGTTGGAAATCCGGCAGCAACCCCAGCATGCCAGGGTGGCACTGGGTAAGGATAAAGGTACGTTTGGT
GACAAAGAATGGAGCAACCAAAGTCTCACGGTCGGGTTGGAGTAGAATGACGGGCAAGGTATTAACTCATCAAAGCAGAC
CGAAAGCCCATCGACCCGCCGCCAATCCTACAACTGAGGGTTAGCCACAAGAAAGACCCGATGCAGCACTTCCTTCAGAG
TAAGCAATTTCCTACCACGCCGACAATGACAGGGGTAAAGTATGCGAAGGTGATACGCAGTTCTAATGCGACATCTCTGA
CTAGGCCCGTATTACTTCATGTCTTGTTCGCTTCTCAAGGGCGACGAGACGTCAAGCAAAGATCCACTTCCAAGTTATCT
CATCGGTACCGTGGTTTCTTCTTTGCATCGACTAAAGGACACGGACAACCAAGACGGCGGGTTCTTTGTCTTTGGCGACC
TGAGCTGCAAAGTGGAGGGCAAGTTCCGCCTGCTGTTTACGTTGTATCAGATGCAGAAGACGGAGTGCTTCCACATTACT
TCGACCGTCTCAGACGTCTTCCAAGTCTACCCGACAAAATCATTTCCGGGCCTAGCAGAATCGACCTTTCTGACCCGATC
GTTCAGCGACCAGGGCGTCCGGCTCCGTCTGCGAAAGGACTCACGCAGCATAACAACGAGGAAGCGGAACGCAAAGGCAG
CCGAGTTTGCACGGAAGACCCAAAGCCAGCAGCATCATGACCGCAGGGTGCTGGCAGGGCGGACAGATAGCACCCATGAC
AGCTCGTCTTATGGGACCATGGCAGGAATATCAGCGGCGCAAGTGGGCTTCGACACCCACGCAGGCACTGTCTATGGAAA
CTACAGTACAGACATCGGGCTTCCGAAGAGACGCCGGATGATAGGCGACGAAGTGACAGCGTCTCATCCGTACGGGACTG
TTGGTGGCAGCAACGGATCAGGCCCAGACATGTCTGCGTACGGTGCGTCTCGCGGTAGCTACAATCCGTCGCCTCATATG
ACGCTTCCAGTCAGCTCGGCATCATACGGCATGTCGGTGATGCAGACCACAGCCGCGACTATGGGATACGGAACAGCGAC
CGGACCTCATCAGCTCGGACGAATGCAATCGCAGCTGGCTGGGGCTCATCAATCCGGGCCTGGCTCGGCCGCGTCAATGT
CGTTCCAGTCGGCACCAAGTCGACAGTCGTCGCACGCTTTCCAATACGGAACAATGCAGCCGGCATCTTCATCGATGGCG
TACCAGCCAGCGAGTGCAACGGCAACATCGATGCACGCCCTGACGGGCAGCCCATCGGGCGACTATCGTTCCCATCCAGG
CACGCTTTACACGAGCAGTGTGTCGACCGACGCGAGCCCGCGATCCCATTCGACTCCCAATCCACACAACTCCACGCCGA
GCGGTACGAGCACGAGTCCGCCCGATGCCACGACAGCAAACTATACGGCGGCGGCGGGTGGAAGCATGACGCCCTTCTCG
CAGGGCTTGAGCCCCTACAGCTATTCCCATGCGTTAGGCGATCCCCAAGCACATATCCCCTCGTCGACAATGGCGACGGC
ACGGTCACACGGCCTCCGCGGGCTGGATCTCCAACATGTCAATGGGGGTGGCCTGGGCCTGGATATGAACTATTCCGAGG
TGGATCGACACACTCACGGTCAAGTTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62