GenePrediction:GLEAN_1871 Details

Name: GLEAN_1871
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1641544..1643106 (+ strand)
Length: 1563
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1641544..1641784 (+ strand)
Length: 241
Type: CDS
Source: GLEAN
Position: GCSC_144:1642097..1642172 (+ strand)
Length: 76
Type: CDS
Source: GLEAN
Position: GCSC_144:1642286..1642303 (+ strand)
Length: 18
Type: CDS
Source: GLEAN
Position: GCSC_144:1642389..1642681 (+ strand)
Length: 293
Type: CDS
Source: GLEAN
Position: GCSC_144:1642728..1642941 (+ strand)
Length: 214
Type: CDS
Source: GLEAN
Position: GCSC_144:1642995..1643106 (+ strand)
Length: 112
>GLEAN_1871 class=GenePrediction position=GCSC_144:1641544..1643106 (+ strand)
ATGTCGCTGCGCCTGTCCCAGATTCTGCGACACCTATCCGTGCCATCTTCCCTGCGCTGCTCGCCGTCATCCACGTCGCT
CTCCCGAGGTGCAGCCGCTGTGACTACTAACAGCAGCTTCTCCTTCCCCACGGCCCGATCCACCATGGCGGCTCCGTCGG
CGGCTATCCGCAATGCCAGCAAGTCCATCCATACGGCGGCCTGTCTCATTATTGGAGACGAGGTGCTGGGCGGCAAGGCA
TGTTTGTTTCATATAGCCCAATAAAAAAGCGAGGAAAGATGAAGACAATCACACAGACAAACTGACCAATGAAACGGCCT
TGAGCTTGTTTAGACGAAAGATGTGAGCTTCATCACCAATAGGGGGGCAGCACGAGAGCACAGCAGCTGACGGCTTGATC
GCCTTTTGTTTCCCGTCGAGACACACGGCAGACCAATTCTACCTACGCGGCCCAGTGGTGCTTCTCGCTCGGAGTTGTAG
GTCCAGACCTCCTGGCGAGCGAGCCTCAGAGTGGACTGACAGACTGCTGCATAGACGTTGAAGCGAATCGAAGTGATCGA
AGACGACGAGAGCCAGATCATCGAGGCCGTCCGCCGAATGAGCGCCAACTATGATTTTGTCGTGACCAGGTGAGAGAGAC
AGGGGAGAGAGGAGAGGAGGAAAAGGAAAGAGGGAAATAAAAGAAGAAAAAAAGAAAAAAAGAAAAGAAAAACGAGATGG
CGTACTGACGGCTCATTTGCAGCGGTGGAATAGGGCCCACGTAAGTTCAGACAAGCGAGCGTGCAGGAAGGATCTGCCCC
TTTTCCCCCGGAAGCCCCTCCTTGTTCTCACGTGGCCGTCTGCAGACACGACGACATTACGTATCCGTCCGTGGCCAAGG
CCTTTGGGTTGGAGCTGCAGCTGTACGAGGAGGCGTACGCCCGGATGCGCAAGCTCTCGCGGCCGCGGCCGTCACAGCCG
CCGATCGACTGGGACGTCGACTCGCCGGAGTTGCGGGCGCGCCTGCGCATGGTCGAGCTGCCGACAGACCCGGCTCTGGC
GCCCGATCAGCAGTTCTTCTTCACGCGCGAGGACCTGTGGGTGCCCGTGTGCGTGGTGAACGGCAACGTGCACATCCTGC
CGGGCGTGCCACGGCTGTGTAAGTCTGCGCCTCCTGTCGCCCTGTTTCTTTTGCTGACGACCAGTCGAAATGCTGCTGGA
CGGCCTGAAGCCGGCTCTGGAGTCGCGGCTGGCCAGCGGCAAGGGCATCACGCGCGTGCTGATCTCGACACCGCTGCCCG
AGAGCCTGGTGGCGCCGTATCTGACCGAGCTGGCTGCCCGGGTCGAGCCCCGGGGCGTCAAGGTCGGCAGCTATCCGCGC
TGGAACCACAAGCACAACACGGTGACGCTGGTCGGAAGGTCTGTCGTTGCCATCTCCTCGCTTGTTGTCCTTCCCTGTGC
TGACAAATCAGGGACGAGGCGTTTATCGAGAGCCTCGTGCCAGAGGTGACGGAAAAGGTCCAGGGCCGCCGTGTGAGCAA
GGAGGGCGAAGATGACGACCTAGAGGAGTCGGTTGAGCAATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62