GenePrediction:GLEAN_1872 Details

Name: GLEAN_1872
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1646720..1647720 (+ strand)
Length: 1001
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1646720..1646731 (+ strand)
Length: 12
Type: CDS
Source: GLEAN
Position: GCSC_144:1646940..1647054 (+ strand)
Length: 115
Type: CDS
Source: GLEAN
Position: GCSC_144:1647137..1647412 (+ strand)
Length: 276
Type: CDS
Source: GLEAN
Position: GCSC_144:1647482..1647720 (+ strand)
Length: 239
>GLEAN_1872 class=GenePrediction position=GCSC_144:1646720..1647720 (+ strand)
ATGGCATCCAAGGTATGTTCGTGCTGCTTCGAGCCTTTCTCTCTCGCTTCTCCTTTTATTTTCCCTAGGCGTTCTAGCTG
TCTTGGCGCGCTACTTCGAGAAGCTCTGAAGAATTGGCCGATTGAGAGCTACACCTACGAGCCACCAGCCTTCGCGCCAT
ACACACATCTCGATGGTTACCATGGAAACTTGTTTGGCTAACAGTTTGCGAACGCGTTAGTTCCTGAGAGAATACAAGCT
GGTCGTGGTCGGCGGTGGTGGTGTAGGCAAGTCTTGCCTCACCATCCAGCTGATTCAGAGCCACTTCGTAGACGAGTACG
ATCCGACGATTGAGGGTACGTTTTAGCCCACAGTGCATCCGGTTACCATCAAGCCGGCGCCCGAGCAGTCAGACTAATCA
TTTCCAACGATGCTTAGACTCGTACCGGAAGCAGTGCGTCATCGACGAAGAGGTTGCCCTGTTGGACGTTCTCGATACCG
CCGGCCAAGAAGAATACTCAGCGATGCGGGAGCAGTACATGCGGACTGGTGAAGGCTTCCTACTGGTGTACTCGATCACT
TCACGGCAGAGCTTTGAAGAAATCACCACGTTTCAACAACAGATCCTGCGAGTGAAGGACAAGGACTACTTCCCGATGGT
GGTTGTGGGCAACAAGTGCGATCTCGAGGGGGAGCGGGAGGTGACCAAGCAAGGTACGAGAAGGCAATGTTCATCTTGGA
CTGAATGATGTATGCCTGTGTACTGACAATGGCTGGTTACAGAGGGCGAGGCGCTAGCAAAATCGTTTGGCTGCAAGTTC
ATCGAGACGTCAGCCAAGTCACGGATCAACGTCGACAAGGCCTTCTTCGATATTGTCCGCGAGATTCGACGATACAACCG
GGAGATGCAGGGCTACTCAACCGGCAGCGGGGCGTCTAACTCGAACGGGCCAGCAAATAAGCTGGAGGTCAGCGACGCCG
ATGCAGACCCAGGATGCTGCGCCAAGTGTGTGATTATGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62