GenePrediction:GLEAN_1874 Details

Name: GLEAN_1874
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1658546..1661537 (+ strand)
Length: 2992
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1658546..1658677 (+ strand)
Length: 132
Type: CDS
Source: GLEAN
Position: GCSC_144:1658876..1659523 (+ strand)
Length: 648
Type: CDS
Source: GLEAN
Position: GCSC_144:1659589..1660711 (+ strand)
Length: 1123
Type: CDS
Source: GLEAN
Position: GCSC_144:1660783..1661537 (+ strand)
Length: 755
>GLEAN_1874 class=GenePrediction position=GCSC_144:1658546..1661537 (+ strand)
ATGCGGCTTTTGGCCGTGGTGTCGGGCTTCGTGGCTGGGGCCGCGGCTCAACTATCCGGATGGTCATCGGACCAGGTCAA
CACCACAATATGCTATTGGGGGCAGCTTCGAGGTATTAAGCTTTTTCAGAGTGTGAGCAGAAGACAAGGCACTGACAGAA
CAGCCACCGCCATCCAGGATACTTTGTATATGGACGGGGGCAGTTTGTATTGGAAAACCCAGACGAAGGATGGGTTAGAT
CCCTTGCAAAAAGATGGTAACGATGCAATCCATCTCTCCCTCATCTATGTACTGCCACTGTTCTTCACTGACAGCAAAGG
CAATCCACAGGGGGTCATCTTGACGCTCAACTTTAGCATACCCTTCAACACGTCGCAGAACATCTCTGCTCTTTTCGGCC
AGCTTAACAAGGGCCCAGAGGGCAGTGGTGCAGGCAACCTTGCGCCCAATTACGTTGACGGTGCTCTACTCAGCAATGAC
CATGAAATGTTTCTCTTTGGCGGGGCACTTGCCAACACTGACAGCTATACGCCGCCGGACGACAAACAGGTCTTTTATTA
TCGGCAATCTCAGTATGGCGTCAACAGGACGTTCTTCTCAGGCTTTGGATTTGTCGATCTGCCCTCAGGGTCGACGCGCT
ACATAACCTACGGTGGTGCAGCTAACGCGCCCTCGGAGAATAAGGCCTGGTACTTCTCGGGTATGCGCTCGCCCGACTGG
GGGGCCATATACCAGACGTCGGCCAATCAGTCGGTAAAACCTTCGAATATATCCAACACGCTCTTCACACTCGACATGAC
CACGCAGCAGGGCGAGTTTTTTGAAAACCGAACGCTGACGGGCTCTGCACGAGGCCGAGCCAGCCCGGAGCTGGTCTGGG
TGCCCGTTGGAGAGCAGGGGATTCTCGTAGCCATCGGTGGAGTTGTCTATCCAGATTTCGTCACCACAGTCCACCAGTCG
AGCAACGCAACGGCCAGTGTGAGTAGATATGCCAGTATACATTTCCGGTCCTGTCCTCTCCCTCATCCTAACATTCCTTA
CAGAAAGCGCAAAGCCCGGAATTCATGACCACAATCGACGTCTATGACGTCTTTAACAAGACCTGGTACCAGCAGACGAC
TACGGGCGGTGGTCCAGGCCAATTGGCGCTGGCCTGTTCGGTGCTGGCAACGGCAGCGGACGCATCCAGCTTTAACATAT
ACCTGTACGGTGGCTATGACGGCCTGGCCGCCTTTGACGACTATAGCGACGATGTCTGGGTCTTGTCACTGCCGTCTTTC
ACCTGGACGCAGGTATTTGCGGGCAATACATCGCATGGCCGTGCCGGCCACCGCTGTTTGCTTCCGTATCCGGACCAGAT
GTTTGTCGTCGGTGGTTCTGCCACCATGTCTGAAACGGAGCCCTGCGCGGAAGGCGGTATATTGCAGGTGTTCAATCTCT
CGTCGACCGAATGGTTGACCTCGTACAACCCCGAAAAGTGGTCCAACTACACCGTACCAGATGCCGTCGTCAAGGTTATC
GGGGGCAATGGACAGGGTGGCGCCACGGCCACAGAGCCGGCTGTGTCCGGTGGTTGGGATACGGCGGCCCTAGGTGCGGT
GTTCTCGACAGCTTACAAGACGTCCATCCCGACGTACTATCCTTATTCGCTAGCCACCACTACGACCAGTGGCACCAACA
GCACATCCACAGCTGTGCCCACACCGAAGGCTACCGGCTCACACGGCAGCAAGGTGCCCTCGTTTCTACCACCGCTTCTC
GGGGTCATCTGTGGCCTTATGGCGTTGTCGCTGTGTGTCTTGGGCTTTGTCTTGTATCGCCGGCGGGCTCTGCTGCGGCG
CGGCTCTCAAAGCGGTGGTCGTCGGTCCAGCCGAGGCGTTGACGGGGCTAGGAGCGATGCCACGTACGACACACGAGCTA
ATATGGTCATAAATTGGCTATTGGGCATTACGAGCGTCAAGCGCTCGCCGACGACAACAGGTGCATCTGCCTATAGTGAA
ACGCTGGATGGGACTACAGGCAGCCCAAGCTCACCAGAGATGGAGCAGCTGCACGGCGGGTCACCGCGTGCTTATCATGC
GTCTGGAAGCAGAAGCGGGACATCGGATGGGAGCCGACACCTGGCAGCGGTTGAGGTCCCCGACACTGCGATCGCCGAGA
TGATGGGTGAGCAAAGGCTTTCTTCTTTCCTTTCTTTCCGTCCGTTTCCTGTCCAGAATGATGACTAATGTGCAAAGCCG
ACACCCATCATCCGGTGGCCGAGCTCAGCGGAGAATCGTCGTCAGCAGGTGCTGCTAGCAGCCGTTTCGGCCGGGGCGAG
AAAGTAGTATCGTTTGTCTCGTCAGCGGCCGAGCTCGAAAGCACAACAGACAGCAGGCGCCACGGCAGAAGGGGTTCTGC
AGTTGTGCCTGCAGTTATTCCTGAGGCTGCAACTGCGCGTCCAGACTCACCTCCCCTTAGCACTGCTGGCCTGGCGAGAG
TGTATCTGCCACCATCAAGATCCGGTTCGGTAGGATTGGCACCAACGCCACCGATTTCGGCGTCGGCACCCACGCCGTCC
TCACCCAGCACAGAGAGCGCATCGCCGGGTGTGGGAAGCGGCAGTCGTCGACGACAACGCGAGTCTAGCATATCGGAGCT
CAGCGACTCTGACCGCAGGCACCTGCGGCAAGGCAGCGAGGGTGGCGACTCGGTGAACTCGGGAACGTCTTCGCTTGTGT
CGCCATCGACACCACAAACGGCGGCGGCCATTCCGGTATTGGCTGGAGCAGCAACAATGGGACGGCCACATCCGATCCCG
GAGGCAGCAGCAGCAGAAGAGGCAGCCGAGGCCGAAACGGCAACAGGGGCAGGTGCAGGGCCACAGACAAATATCCCGCC
ACCATCCTTGATAGCACAGCAGTCTGCACCGGTTCCACCATCTCCGGGTGGCAGTCTGGGAACGTTGCGACGGAGCATCT
TCCGAGAGAGCGAAGAAGACATGAGTGGATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62