GenePrediction:GLEAN_1875 Details

Name: GLEAN_1875
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1669018..1670970 (+ strand)
Length: 1953
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1669018..1669036 (+ strand)
Length: 19
Type: CDS
Source: GLEAN
Position: GCSC_144:1669211..1670970 (+ strand)
Length: 1760
>GLEAN_1875 class=GenePrediction position=GCSC_144:1669018..1670970 (+ strand)
ATGAAGTACGGAAACGAGAGTAAGCAAGGAGAAAATAAACAAACGAGTAAGTAACAGCAAGAGAAGCCTAACGTGGGGTA
AGAGAACAATAGGAAGAGGGCCACGATAACGGTTACGTAGTGTTAGTTGCTAAGGCCCTAATTTACGCATGCCGGTCCAA
CTGTGTGATTAGTCCGGAGTGTCACATGACCAGCCTTATCGCAGCTGTTATCGTGTTCTCCTCACCGACCGGCCGTGGAG
ACGGGTGGACAGACGAGTCTGGTCCTGTTCGCTTCCACGCCACCTCGACGACGACGACGATCTGACGTCTCCCGACGGCT
CCTCTCGCTGCACTCGAACAGCCCGCGAGCAAGCAGCAAGCAGCAAACAGCCACAAACGAGCGCACGCCCCCTCCCGACG
GGCCTCACACCAGACGGAGGACCCCGCCTGCACTCCGGCTGGCCATGGCCGACGACCTCGACTCCCTCGTCAAGGGGGCG
CCGCTGTCTGGGCCAGGCAGTCTCGGCTACAAGGCGGCAGCGGCACTTGGGCTTGGCGGCCCCGGCTCCGGTAGCCCTGA
CGGCGACCCGCTCTCGCACACGCCCGGCTCGCCGGCGATGATCTACCTCAACCTGCTCATCCTCGAGGCATCGCTGCGGG
CCCAATACCTGGCGCTGCGGGCCCGCCGCCGCCACCACACCTTCTTCCTCATCCTGCTGAGCGGCTGGATTCTGGGCTTC
GGCTATGCGCTGTTCCTGGCGCCGCGCGAGGACGGCAGCGGCGTGGGCGGCTCCGTCTACTGGGTCGTCGACGTAGCCGA
AAAGGTCTGCTTCATGGGCGGCGCCATCACGGCCGTTCTGATCTGGGCCACCGGCATTTGGGACCGCGGCGTGCGCTGGC
CGCGTCGCTGGTTCAACGTGTCCAACCGCGGCCTGCGCCACATCAACTGCAAGCTCGTGCTGATGAAGCGTTCCTGGCTG
GCCGAGACCCTGTCCACGCTGGCCTGGTTCCTGACCTACGGCCTGCTTTCCAACGGCGCCGGCGTCTCGTCCTACCGCTA
CGTCGAGCCCGCCATCCTGCGTGAGGTCGACCGCGAGCTGCACCTCTCGGCCACCGGCCACCCGTCTGTCAGCCCCAGTC
CCGGCCGCACCGCTTCCGGCACCAACACCATACCGGCCATCATCGTCCGCGACGAGGAAAAGGGCAGCAGCAGTAGCAGC
CGTGCTGCCGCTGCCACCCAGCACGCCACTCACGGCCACGGCCACGGCCACGGGCACTCTCACTCCCACCCCGGCATGCA
GCACCTGCACGCCCACCAGGAGGATCTAGCGCCCGGCGGCGACTATGTCAAGCTGCTGCTGCTCGCCAAGCCCTTCTCGC
CCACCTTCCGCGAGAATTGGGAGCTGTACCGCCAGGAGTACTGGGAACGCGAGAACGAGCGTCGCGCCCTCATTCGCCGG
AAGCTCAAGGAGCAGGACCGCGCCCTGCGTTACAACTCCGGCAGCTGGTTCTGGTGGCTGCCCGGCCGCCCTGCTGTCAC
TTCCAGCGAGCAGCAGCGGCCCTACACGCCGCGTGGCCGGGGTGGTGACATGGGCGGCAGCAGCGGCGGCAGCGGCGACA
AAAACGCCCACCACCAGCTGCACCATCCGCGCCACGTCGCCGTCGAGCGCGAGCATCGCCGCACGCGCAGCAACAGCTCG
CGCCGCGGCAGCATGTCGACGGGCTCGCGCAGCGGCACACCGGCCGTGGAGGTCGAAGACACTGCCGCTGCCGCTGCGGT
AGGCCGAAAGGAGAGCACAGGGTCCTGCACATCTGACCGGCGGAGGAAGAAGTCGTCCGTGTCGACGGCCCCGGCGATGA
CACGCACCATTTCGGCGGCGGCTAGACGGCCCAATGCGTCGGACTCGCGCTCGGTCACGCCCGAGATCCCGTCGCCGCTG
GCCAGAGAGAACAGCATGTCGGCGGCCGGATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62