GenePrediction:GLEAN_1877 Details

Name: GLEAN_1877
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1673651..1676925 (+ strand)
Length: 3275
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1673651..1674256 (+ strand)
Length: 606
Type: CDS
Source: GLEAN
Position: GCSC_144:1674313..1675214 (+ strand)
Length: 902
Type: CDS
Source: GLEAN
Position: GCSC_144:1675538..1675823 (+ strand)
Length: 286
Type: CDS
Source: GLEAN
Position: GCSC_144:1675880..1676117 (+ strand)
Length: 238
Type: CDS
Source: GLEAN
Position: GCSC_144:1676186..1676925 (+ strand)
Length: 740
>GLEAN_1877 class=GenePrediction position=GCSC_144:1673651..1676925 (+ strand)
ATGCCCAAGCTTCGTCCTGCCACCAGCCGTCGCCAGCCCGGCCGTTATAAGGAGTTCGCATGCTCTGATTCCGGCTCGTC
TGTGGAAGATCAAGAGCCACCACGCTCCTCATTCGCCCCCGAGCTCAGCTGGACAACTGCATTTCCCACTCGTGCGCTGG
ATGACCCTCGTCGGCACCCAAACGAGGCTCTCGCAGACTTCCACCGGGCAGCAGACCGGATTCTGAGGCAGCCCATTTCT
GTGTCCTCCAGCGGGCCAGACAGTGCTGCTGCTACGGGGCTGATATACCAGCAAAAGGAGGACTTCTTGACACAGGCCAT
TGACTCGGCAGAGGAGCAGCTCGAGGCTCAGTTTGCCCGCTGGCGAAGATCATTCTCCATGCCTGCTGGGAGCTCCAAGG
CTAAGAGACGAGGGAATGAACAGGTTGGCGAGTCGCCACAGACAGTGAAGAGACAGAAGATCAAGTCAGACCGATCTAAG
ACCGCCGGTCTTTCCATCAGCAGCAGCAGTAGCTTCGATAATAGCAGCTTCAACGTAATGACCGGCAAGTCGGGCTGGGG
CCTCCAAGGTGACCAGGCTGGCTCGACAGTAAAGAGCATGAAGAACGTGAGTATGAGGCAGGCAGCCAGTGCCTCAGTCC
TTGCTAACAGGGCCTTGTCCAGAACCGAGGAGGCACCTCGTCGACCAGCTGCACCACTTGGCAAGCTGTGCCCGACAATA
TGAAACTCATCGTGGTTAGGGAGCTCACCTCGTGGTTTGCCTATGATGAGACAGTGACCTTGCTCAAGCTCACCAGCGTC
GAAGAGGCGGGCTTCCGCGCCCTGTACGATCGCGAGCAGCGCAAGTTGGCCGCCTACACAATTGCCCTCCGCCAGTATGA
GGCATCCCAGGTCCACGAGCGCGAGCTGCTCCGCTACATCACAATGTCACAGACAGCCAGGGACATCTTTCCGAGCGGGT
TGGCCAGCCCCGTCGAGATGCCTTTCAACTCTCGCTACTACTTGCCGCCTATCGCGGACCCAGGCCTCATTACCGACATT
GTCACCGTGCGGCAGATTACCATGGCACAGGAGTATCTGAGCAGCGTCGGCTTCGTGCGCGACACTGTCGACCTGGGCCA
CTGGCTCGGTCACAGCGGCGGCGGCCGCTTCGAGATCGACATGTTCAGCAATTGCAACGGATGCGAAGAAGGGGACCACG
GCCACGGCCACAACCAGCCTGTCATCGCCTTGAAGGGTCATTCGCGTCTATCGCCGCGTGGCCTAGCACCCGCAGCTGCC
GGCACCGGCACGGGCGACACCGTTAAGCGTCGTCGCAAGAAAGCCGCCCCGGAAGATTCCATGCGGGACGCAGCTGCCGA
CAGCGTCGAGGTGAGGATGCCTGTTGTTCCGGCGGCAACGAGCACCAGAGGCCGAGGTAGCGGCCGTGGAGGCCGCGGCA
GGGGTGGCGGAGGTGGACGCGGAAGGGGAAGGCAGCCGAGCTTCAAAGTGCACGTTCAAGGGACTGGTAGCAGCAGCCAG
CCGGCACTGATTGACGAGGCTGATCCCAGTGTCGCAGTGAAAGGGTAAAGCTGCACAGTAGAAGCGCCTGGGAGGGGGTA
GTACGGTATTACACAACATTGATCGACCGGGCTGCAAGGAGAAAGGAGAACTTGCGAGGATGTCCCAGAATTGGAGCGAT
TAGGGAGTAGTGATTAGTCATCAATAAAACCCCTAGCGAAGCTGTTGCGGAGCACTTTAGTGGCGATCGATCCGAGCTTC
AGCCTACGAGCCTACGGAGCATTGCCAACACTGCAGGAATCGGCGACGTTATCGGCATCGGCGAGTAATAGTAGGGACGA
AAATCTGGCACTTGACATCGAAGATCGGTCTGAGACATTCGAAGAAGCGATACGCTGCTCCGACACGAGGGCAACGCGAC
GCGAGAGGCAGCCATGGCGCCACCACGGATCGAGCAGCGGGAGATTGACACGTACTGGAACATCTTCTCGGCGCGGACGA
ACGGCGGCAAGTTCCTGACGGGCGAGCAGGCGGCGCCGGTGCTGAAGAACAGCGGGTTGCGTGACGGGCAGCTGGAGCGG
GTGTGGGATCTGGCCGACGTCGACAATGATGGCAACCTGGACTTTGAGGAGTTTTGCGTGGCGATGCGGCTGATCTTTGA
CATTCTGAACGGGGTGGGTAGCTGTTGAGCTTCGTGTCTTCCGTCTTTGCGCCCGCTGACAGCTCGCAGGAGTATCCCGA
CGTTCCGAACACGCTGCCGGACTGGCTGGTGCCCGAGTCCAAGGCACATCTGGTGCAGGCAGGCCGGGCGCTGACGGGCA
AGGCAACGCAGTTTGAGCAGGTCGAGGTCGACGATCCGGACTCGCCCCCGCTCAAAGACGGCTTCGACTGGTACATGAGC
CCGGCCGACAAGTCCAAGTACGAGCAGATCTACATGGAGAGCCGGGACATGCGCGGCGAGGTATCGTGTGAGTGGCCTTG
CGGACGTGTTGCGTTTTGGATCTTGGTCTTTGGATCTTGCTGACAGAAGTTGCAGTCCCTGCGCTGCAGGACCTATACGA
ATCGCTTGAGGTGCCGGACACGGACATCCGGTCGGCATGGAACCTGGTGAACCCGTCGGCAGGCTCGTCGATCAACAAGG
ACGCCTGCCTGGCCTTTCTGCACATCCTTAACTACCGGCACGAGGGCTACCGGATCCCGCGTGCGGTGCCGGCGTCGCTG
CGGGCCAGCTTCGAGCACAACAAGATCGACTACCAGGTCGGCAATGCCAGCACGGCGGCGGCCAACTCGCGCTGGGCCAC
GCGGGCCGACGACTCGACATCGACCGGCCGCAAGGCCAAGTTTGGCGACCAGTACCTCACGCGTCTGGGCCGTTCCGGCT
TTGCCAGCAGCGGCACGGACTTCTCAGCCGAGCAGAAGACGGAGGACTGGGAGGAGGTCCGGCTGAAGAAGCAGCTGCAG
GACCTGGAGAAGCGCATCGCCGACATCGAGGGCGGTGCGGCGCAGCGTTCGGCCGGCGGCGCTGGCGGCAAGCGCGACAC
CAAGCCGGCCCTCGTCAAGCGCGAGCTCGAGCAGCTGCTCGACTATAAGCGCAAGGAGCTGCGCGATCTCGAGGACGGCA
CCGGCAAGGCCAAGGCGGCGTCCAGCCTGCACGGCGTCGCCGACGACCTCAGCACGGTGCGCGAGCAGGTCGAGAGCCTC
GAGGCCCACCTGCGGTCGCGGGAGCACATCCTGGAGCAGCTGCGGCGGGAGATTGACGACGCCAAGGTGAGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62