GenePrediction:GLEAN_1878 Details

Name: GLEAN_1878
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1677502..1677959 (+ strand)
Length: 458
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1677502..1677592 (+ strand)
Length: 91
Type: CDS
Source: GLEAN
Position: GCSC_144:1677673..1677740 (+ strand)
Length: 68
Type: CDS
Source: GLEAN
Position: GCSC_144:1677807..1677959 (+ strand)
Length: 153
>GLEAN_1878 class=GenePrediction position=GCSC_144:1677502..1677959 (+ strand)
ATGTCTACTTCCGAGGCTTTCAAGCAGGCCGTGCTGGACTCCAAGAAGCTCACGTCCAAGCCGAGCAACGAGGAGCTCCT
GGACATCTATGGTATGCCCACCAATGGGACACTCAAAAAGGAGATACAGCGCCACAAGGGACCACCAGATTACTGACACG
CCGTGCTGCAGGCCTCTACAAGGTGGCCATGGGCGAGGACATCACCACGGCCCCGAGCCCTGGCATGTTTGACCTCAAGG
TAAGTGCTTCCTTCCTAGCTGTGCCTAGAGACTATCTCGGGATTCTGACCCGCCATCCACAACAGGGCAAGGCAAAGAAG
GCCGCCTGGCAGAAGGCCGTCGACGAGGGCCTGACCGCCGAGCAGGCTCAGGAGCGTTATGTCGAGTACATTGAGAAGCT
CAAGGCCAAGCACGGATACGATGCGAGCAAGGAGCCCGAGACTGTCGGCTCCTCGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62