GenePrediction:GLEAN_1879 Details

Name: GLEAN_1879
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1680832..1683213 (+ strand)
Length: 2382
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1680832..1681076 (+ strand)
Length: 245
Type: CDS
Source: GLEAN
Position: GCSC_144:1681135..1682788 (+ strand)
Length: 1654
Type: CDS
Source: GLEAN
Position: GCSC_144:1682866..1683213 (+ strand)
Length: 348
>GLEAN_1879 class=GenePrediction position=GCSC_144:1680832..1683213 (+ strand)
ATGAGGCTTCTTTCGCTCGTCTCGCTATTAGGCGTAGCTGTCTTGGGCGCAGCTGCAGAAGATGCTGTCCCAGCAGCTGC
TCCGGCAGCCGCTCCGGCAGCCGCTCCGGCAGCACCCCCAGCAGACCTGCCACCGGGCTGGACCATGTTTGACGGCGTCA
AGGTCCCACCGTTCAACGAACTGACGCCGACAAACTTTGACCAGGAGTTGGCCCAGTCCAAATTCATGATGGTGAAGCTG
TACAGGTGAGCAGCCCCTCTCTCTTGTATGGTTGCGCTTCTGTCGCTAATGTTCGGCACGCAGCCCTTACTGCCATCACT
GCAAGCGCTATGCGCCGACCTTTCAGAAGCTGTACGAGTACTACCGCACGGCGATAGCTCCCGGTGGCGATCCAACCGTC
ACCGCTGACAAATACTACAACATCCAATTCGCGTCTGTCAATTGCGTCGCCCACTACGATTTCTGCGCGAAGCATGGGGT
GAAGTCGTATCCAACTACGAAGCTGTTCGTGGACGGCGTGGTGACGACCGTCTTCGAAGGCGTCAAGACCATGGAGGAGC
TCGGCACCGCCATCGAATCTGCTTTGGAGGCAGCACGCCCAGGCACGCGGCCGAATCCGGTTTTGCTACCCGTGGAGGAA
GCTGCCGCCCACCCTACGATTGCCGCAGAGGCTGGGGCAGTCATTGCCCTGCAGTCACCTGCAGCTGCTTCTGCCATCCC
TGCTGCTGCGGACGGTACTGCCGTGAAGGTTGGGGCTGCAAATGATGCCACGACCGGAAACACTGCCAAAGACGCTGCTG
CTGGTAGTGCCACGGACAGCAAGGATACCAGGCGCAATAAGGACAAGTCCAAGAAGACCTCGCCCGGTCCGGTCTACCGG
GGCCCACCCAAGTCGACAGCCACGCCGAACCCCAACGGGATATCACAGAAACTCAACGCGGAGTCATTCCAGACACTCGT
CACGACGACGCAGGACCCGTGGTTCATCAAGTTCTATGCCCCGTGGTGTCACCACTGCCAGGCTATGGCGCCAAATTGGA
ACCAGCTGGCAAAGGAGATGCGAGGCCGACTTAACATCGGCGAGGTGAACTGCGAGAAGGAGTCACGGCTGTGCAAAGAT
GTGCATGTCAACGGCTACCCGACAATTCTATTTTTTCGGGGCGGCGAGCGTGTCGACTACGACGGGCTGCGCGGCCTCGG
CGACTTTGTGCAGTATGCCGAGAAGGCGGTTGACATCTGCGAAGGCGTCAAGGACGTTGACGCCGTGTCGTTTGAGGCTC
TGGAAAAGAAAGAGGACGTGATCTTTCTGTACTTTTACGACTTTGCCACCACTGGGGAGGACTTTATGGCGCTGGAGCGG
CTCCCGCTGAGTCTGATCGGCCATGCGAAGCTGGTGAAGACCAACGACACGGCCTTGTACGATCGATTCAAGATCACGAC
GTGGCCGCGGCTAGTCGTGTCGCGCGAGGGACGACCGACGTACTATCCGCCGCTGACGCCCAACGAGATGCGCGACACGC
ACCAGGTGCTGAACTGGATGAAGTCGGTGTGGTTGCCGATCGTGCCGGAGCTCACGGCATCGAATGCACGGGAGATTGTG
GACGGCAAGCTGGTCGTGCTGGGTATCCTGAAGCGGGACGACCCAGAGGGCTTTGCCAGTGCGATCCGGGAGATGAAGAG
CGCGGCCAGTGAGTGGATGGACAAGCAGATCCAGCTGTTCCAGCTGGAGCGGCAGGAGCTGCGCGATGCCAAGCAGCTGC
GCATTGAGGAGGCCGAAGACCGCAACGACCAGCGGGCATTGCGGGCGGCGAAGAGCATCCGGATCAACATGGACCGGGCG
GACAAGAAGGAGGTTTCCTTTGCCTGGGTCGACGGCGTCTTCTGGCAGCGGTGGCTGCGCACGACATATGGCATTGACGT
CAAGGACGGCGAGCGAGTAGTGATTAACGACGAGGACGTGAGTTTTTCACTTTCTTATCATTCTATTTTGTGTCGGCCTC
CTCCGTCTTTCTTTTCCTCTGCTAACCCCATCAGAACCGGCGCTACTGGGACCAGACCATCACGGGCAACTCGATCTTGC
CATCGCGAACATCGATTCTGGAGACGCTCAATAAGGTGACAGCGTCTCCGCCGAAGATCAAGCCGAAGTTGACCATCTCG
AGCATCGAAAAGGTCTTTTTCGACATACGGGTGACCTTTTCGGAGCACCCGTATCTGACAATCGGCTGCTTCCTGGGCAT
GTCGCTGGGCGTGGCGTCGTGGTTCCGCGGCCGGGTCCGGTGGACACGGGGACACTCCCGGCTGGAGGACAGCCTGGGCC
GGAAAGACTTCAAGCTGCCCATCCTAGGGACCGGGCTGAACGCGAACGGCAAGGTAGACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62