GenePrediction:GLEAN_1881 Details

Name: GLEAN_1881
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1693593..1694840 (+ strand)
Length: 1248
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1693593..1693821 (+ strand)
Length: 229
Type: CDS
Source: GLEAN
Position: GCSC_144:1693879..1694840 (+ strand)
Length: 962
>GLEAN_1881 class=GenePrediction position=GCSC_144:1693593..1694840 (+ strand)
ATGAGCATCCGGAGTGGGAAGAGCGCCGGCAGGACCGAGACGCCCCCTCCACCGACTATTCCGCCTCGGTCCCGGCTGCG
TTCATACTCGTCGCCGGCCGTCGAGTCTATGGTTGAACGGATTGCCGGTGCTATGATCGAGATGGAAAAGCTGCAGGCAG
ACATCGACTCGGTCGTCGAGAGGCAGAGCCTATATGCCAACAGTAGGCCATCGACGGTCTGCAGGCAGGGTGAGAACCCC
GGTCTTTCTATGGGCATTAGTCAGCACATACTGAGTCGTCCGTCAGACTTCGAGCCGATGCCTTCCATCCCGGCCACGCC
GTCTGCAGCGCCATCTTTCGCCGAGCGACTGAGTACGGAGCGCCCAAAGACCGCACCGCCTCGCAATAGCACGCCTATCT
CGCCGATCACAGAAGAAGGGCGCAGCACACAGCCTAGTATTGTGCCAGCGCCACTTTATCTTCTCTCACGACGGACTGAG
ATGGTCACACCTACTAATGTGTCCCCGAAAACGCCACCGATGGCACAATCCCAGACTTCCAGATCATCCGAACTTTCTAT
GTTATCGGCTGCTTCGGTGGTGTCTGCAGCCACCGCAGCTACCAAAGCCAAAGCTGCCGCATCTGCATGGACGGGTTCAC
GAATCAATGGGCGTCCCATCGACGTTCCCTTGGCGCCGCCTTTGCCGCTGGTGTTGCGGCCACCGCTGCGGAAAAAGAAG
TCGTTTTCGCGGGTATCGAACTGGCTTTTCCCTGGAGACAGCGGCCACAACAATGCTAGCCATCAGCAAATGCATAAGCG
CGGTATGAGCTTCGACTCGGTCACAAACCTTCCGCGGCCTGTGACCGACAAGGACGGGTATTATCAGTGTGTCCTGCCGC
CTACTCTTGATGGACGAACATACGACCGAACCAGCATGGACACCGCATTGACCGTGGACACACTCTCTACATGGACAACT
GAGCGAGAGAACGAGAGAGGACAAACCTCAGAGCGCCAAACGGAGATTGTGGACAACGGCATGGAGGAGGACGATTATGA
GTACGGGGACGAAGACCAGACAATCTTGACGGACACATGGTCACCAAGCAGCTCGCCGGTGACGAGTAGACAGGAAACGG
CAACGACAACACCGTCAACGGTCACAACTATGACCCCTGTTGTTGCGTCCGCCCTAGCCACCGAGAAGGCGTCTAATTTC
GGGAACGGTATACTGAGCAGACCGCAAAGTGTTGGCGTGGCTTTTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62