GenePrediction:GLEAN_1882 Details

Name: GLEAN_1882
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1697091..1700209 (+ strand)
Length: 3119
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1697091..1697415 (+ strand)
Length: 325
Type: CDS
Source: GLEAN
Position: GCSC_144:1697538..1698021 (+ strand)
Length: 484
Type: CDS
Source: GLEAN
Position: GCSC_144:1698309..1698605 (+ strand)
Length: 297
Type: CDS
Source: GLEAN
Position: GCSC_144:1698685..1700209 (+ strand)
Length: 1525
>GLEAN_1882 class=GenePrediction position=GCSC_144:1697091..1700209 (+ strand)
ATGTCGACAGGCATATCGGCAGCATCCAGCTTAACGCAGACTCCATCCGCTGAGCAGAGCTCTACGTCGAGCTTCCCCCC
AAGTCTTGATGCTCAAGAAGAGCCTTCATTGGAAGAGATTCAGCTGAAGCCCTGGAAATTCATTGGCTACAACGGATACT
CCAAGTTCATTGCCTCCGATACCGATTTCTTCATAGTGCGTCGGTTTGACACTTTAAATGCACGTGTGACGCTTGCTTTG
CAGGACCAAATATCTGCTCTGGAAGAAGAGCTGGCCGAGCTAGACAAAAAATACAGTCGTCGAGACGCCGAAGACGTAAA
CAACGGTACATTCAGGGATGATCTTGAAGATCGAACAGCTCTGTTAGACACAATATCAGATGAGCTGTATCGTTACAGTC
CGTTCTCATCCTTGTTTCAGAAAATACCAGAGCTGACAGAGCCGTAGACAAGCACATTCTGCAGCAGTCCAGTCTGAGGC
AATTTTCCAAGGCACCGATGCGAGACATCAAGAACATTCGCACCTGGCAATGCAATTATGACAATGCAGCCATCAGCGAA
CGGGGTTACCTCACGCATGAGGAGGACCTCATATGCGTAGTAAAAAAGGACAAGATGCCCCTTCGCCGAATGATCGACAG
CTCTCGGCGACTTCGAACTCTGCGAATCTGGCGACAACCCTCGAAAGACGGTTCTCCGCCTGATGACGACACAGTTCAAT
ATTACCTGGATAAGCGCATGGATGATTTCGCCACAGGTGTAATAATTGCAGTCGGCATCTTCATGCTGATCACACCGCTT
TGGGTTCTTCAATTCATGGCAAACACAACAATGAAGCTCGTCGTTATTACAGTTTTCATATTGGCTTTTTTGCTGATGCT
GTCATTTGCCATGGCCTCGAAACCGTTTGAAGCGTTAGGGGCTACAGCTGCGTAAGTGCGAAGTGCGAGTTTGAATTGTC
ATACAGAGAGGACGGCAGCTAACTCGGATGGCAACAGCTATGCAGCTGTTTTGATGGTGTTTATCCAGGTTGGGTCGCCG
TCATGAGTTTGGCGGATGTCAGTGGTCTAAACTTTGATTGGCTGGCGCAGAAAGTGGCAGCTTGTGTGGATAGCGGGTTT
CAGGGCGGTTCCTTCCCAATTAGCACTTGTAGGACATTCATCTCTCTCATCGAATAAAGCTTCAAATCATCCCGAGTACG
TTTATATAACAAATACAGGTCTATCATAATCAGCTTCACAATGGGCCTGGGGTCTGCCAAAGATGCTGTCCGCTCCTTTT
TGGACCGCGATTTTCGATACCAGCGCCTCGCAGAAACGAGTACCAACTCACATGATCGTCGCGGTCACTTCTCACGGCTT
AGGAGACAACCACGCGGGCTGCTACCACAGACGGAGAGCGGAAACGAAAGTGGCAGCGTATCTGGGGTGTGGGCACGCAG
CAACCGGTCGCTGCTCAAGCTGAGCCTCATGACTGTGTCGATTATCCTGGTATCATACCTCGGGATCACCTTCTCGTGCG
TAATTTTTCACGTCTCCCTACAGGCCAATTTCCTTCTTTTTATAAACTATCCACTGACAATTGTCGTACTCCAGCCGGGC
TTCAAAGGTTATAAAGGGTGCTTCCTGCGATACCGTTGACCATGGCTACCAATGCTATGCGTCCGTGGCGCAGCAATGGG
GCCAATACGCGCCTTTTTTCTCTGTGCCGTCGCCCACAGACTCTGCTGTTGCAGGCGATGTCTCAGGGGGAACGGACCAT
GTCTTGGATGCGGCAGAGCTCCCCCCCAACTGTCACTTCACGTTCGCTCAGGTGCTGTCGCGTCACGGCGGTCGCGATCC
CACGGCAGGCAAGTCGATAGCGTACGGGGCGCTGATTGAGCACATCCAAGACTCGGTGGAGCGCTTTTCGGATGGCCCGG
ACGGGAAGTTTGCGTTCTTGGCCGACTACTCGTACCAGCTCGGGGCGGACGAGCTGACGGTCTTCGGCGAGCGGCAGATG
GTGCACTCGGGCGAGCACTTCTTCAACCGGTACCGCTCGCTGGTGGTGTCTCTGTCGTCCTCGACCTCGTCTGCCTCATC
GGTTGTCATGCCATTTGTGCGCTCAGCTGGACAGCATCGTGTGCTCGTATCGGCGATCGATTGGATCCATGGTTTTCACA
AGGCGCGGAAGCAGGACCCGGCCTTCGCCACGGAACAGCTGTCGGCGACGGCGGAACAGCCGCTCGTCGTGATCCCAGAG
GAGAGCGGCTTCAACAACACGCTCAGCTACAACGGACTCTGCAAGGCGTTTTCGGGCCGCGCAGGCCTACAGGCGCAGAG
GACGTATGCCGAGACGTTTGTGCCGGACATTACGGCGCGACTGAACCGGGGTCTTCCGGGATCCAACATTTCGGACGTTG
ACACGATCGCCTTGATGGACCTGTGTCCGTTTGAGACGATTGCAAACGGGGACGACGACACCGACGGCGCGGATGGCAAG
ACGAGCGGAGGGCAGCGGTTGTCGCCATTCTGCGATCTGTTCTCGGAGACAGAATGGCAGCGCTACGACTACTTCCAGAC
GCTGGGCAAGTGGTACGGCTACGGTGACGGCAGCGCGCTGGGGGGGACGCAGGGCGTGGGCTACGTCAACGAGCTGGTGG
CACGACTCACAAAGACGCCGGTGGTCGACCACACGACGACGAACCGCTCGCTGGACGCAGACCCGGCGACCTTCCCGCTC
AACGCCACGCTGTACGCCGACTTCAGCCACGACAACGACATGGCCAACATCTTTGCCGCACTGGGCCTGTACAATGGGAG
TGACGATGCTATTGCCGGCTTCTCGGCGCCGCTGCAGCCGTCCAATACGACGCGCACCGAGCCCGGGGACATGCGTGGCT
ACGCGGCCAGCTGGGTGGTGCCGTTTGCAGCGCGCATGTACGTGGAGAAGATGGTGTGTGACGGCGGCAACGACGGCAAC
GACGGCAGCGAGGAGCTCGTACGCGTGCTCGTCAACGACCGCGTGGTGCCACTGGTGCGCTGCGGCGCCGACCAGCTCGG
ACGCTGCACGCTCAGCCGGTTCATCGACAGCCTGGCCTTTGCCCGCAGCGGCGGCCACTGGGACGACTGCTTTGCCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62