GenePrediction:GLEAN_1884 Details

Name: GLEAN_1884
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1712178..1714585 (+ strand)
Length: 2408
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1712178..1712444 (+ strand)
Length: 267
Type: CDS
Source: GLEAN
Position: GCSC_144:1712683..1712913 (+ strand)
Length: 231
Type: CDS
Source: GLEAN
Position: GCSC_144:1712984..1714585 (+ strand)
Length: 1602
>GLEAN_1884 class=GenePrediction position=GCSC_144:1712178..1714585 (+ strand)
ATGGCCGAACCACGACAAAGACGGACGCCCGTCGATGCGCCGTCCAAAACCCCCGCTGTCTCGTATGCCGACGCTGCTGC
GGCTGCCCCCGTCCACGATGAGGTGCTTGCGGCCCAGACCGCCGACGTCCTGACGCTGCTGCTGATCTTGCGCTTCTGCA
GCGCTCTTTGTGTCCGCACCTTCTTCCAGCCGGACGAATACTTTCAAGCATTGGAGCCGGCTTGGGAGTTGGCTTTTGGG
CCAATTAGCGGCGCCTGGTTGACATGGGTGAGTGATTCTCGTTCCCTCTTTCCTCTTTCCTCTTTCCTCTTTCCTTCTTC
CTCTCTCCTTCTTCCTCTTTCCTCTTTCCTCTTTCCTTCTTCCTCTCTCCTTCTTCCTCTCTCCTCTCTTCTCTCTCCTC
TCCTCTCTTCTCTCTCCTCCCTCCTCTCCTCTCTTCTCTCCTCCCTCCTCTCCTCTCTTCTCTCCTCTCCCTCCTTCCTC
CTTCCTCCCCTCGCTAACTAATCAGGAATGGCGCCAACACCTGCGAACATCACTACATCCAGTCCTGTTCGCTGTCGCCT
ATGCCGCTGCCGACAGTCTGCTCCGCCTGATGCACTGCGTCGGTCCCCTGCGTGCCATCATACTGACACACCTGCCGACG
GTCGTCCAGGCCGTCATCGCCGCCGTGGCCGACTTCTCTGTCTGGCGGCTGGCCGGTCATCTGTACGGCCGCGATAGCAA
CGCGACCTGGACTGCGGTATGTCTTGTGCTTGACTCTCACCCTGCTGCCTGCTTGCCATATGTTTCCCCCCCGGCTGACA
GTTCAGCTCTGGCTCTGTGTCCTCAGTCCCTGGCAGTGGTACTGCGGCACACGCACGTTTTCCAACGGCCTCGAGGCTGC
CCTGACTTCAGCTGCTCTTGTCTTCTGGCCCTGGCAGCTGTTTGCCGCCGACTCCACGTCAGCAGAGTCGCTTTTCGACA
GCAGCACTGCCTACAACACTGTCGGACGTGTCGGTCCCGTTGGCCGCCTTCGCCTCTCCCTCCTGCTGGCTGCCTTTGCC
GTCGTGCTGCGACCGACCAATCTGCTCATCTGGGCTGCCCTCTTGACGGTGGCCGTCACTCGTCTGACGCTGGACAGCTC
TTCTTCTTCTTCCTCTTCCTCCTCACCTCTCCGCCCCTCCTTTGTCGCCCGTCTCGCCGTCGAGATCGCTGCCTGTGGTA
GCCTCGTGCTTGCTGTCTCCGCCGTCTCCGATCGCCTCTTCTACGGCGTCTGGACCCTGCCCGCATACACCTTCCTGGAC
GTTAACCTCGCCCAAGATGTCGCCGTCTTCTATGGCCGCAACCCCTGGCACTACTACCTGTCACAGGGCCTCCCGCTGCT
GACAATGGCCAGCCTGCCGTGGGCCCTGACCGCCGTCTATGCCGCCTTGACCTCGTCCTCTTCGCCCTCGTCTTCCTTCT
CGTCCAATGCACGTCGCGCACTCGCCTTTTCCGTCGTCACTACTGTCGCTGTCCTGTCGCTTGTCGCCCACAAGGAAGTC
CGCTTTCTGTATCCGCTGCTGCCTGTCCTCAACGTGCTGGCAGCTCCACAGGTGGCGTCTTTCTTCACTGCCACCCTGCC
CTCGACCTCGTCTGCCTCAAAGGCCCCTCCTTCGGCCACTTCCCTTCGCCACAAGCGGCTCTTGTCCGTCGGCCTCGTCC
TCCAGGCCGTTGTGGCCGTCTACCTGTCCTTTTTTCACCAGCCGGCACCGCTGTCGGTGCTCTCCTTTCTGCGCCACGAG
TACGAGCGCATCCACCACAACTGGTTAGAGTTGACCGCCGCCGAGTTGCCCTACTTCGACGTCTACCCCGACTACTCTTT
CCTCCACCAGTCATCAATACCGTCCATCCTCGCCAGCGGCGGTGGCGGCGACGAGCTGTTTGCCCTCTTTCTGCTGCCGT
GCCACTCGACGCCCTGGCGCTCGCACCTCGTCTATCCCGGCCTGCGTGCTCGTGCCCTGACCTGTGAACCACCACTGCAT
ACTGCGCCTCGGTCTGCCGAGCGCGCCGCCTATCTGGACGAGGCCGACCGTTTCTATGCCGCTCTCGGCCGCCACGATCC
TGCGGCCCGGAATGCCTTCTTCGTCGAGGAGCTGTGGCCGCGGTTTCCATGGTCGTCCGACGCAGAAGCAACAGAGGGCA
CAACGACTTGGATGCACAACGGCGAGATCCCCCGCTACATCGTCGGCTTCGAGGGCATCGAAGACGTGCTCGTCGGTTAC
TTCGCCTCTGACGATCCTGCCACCGGCGGCGCCGATCTGGGCATCTCCCTGCGGCGGGTGTGGACCGGCTGGAACGGCTT
CTTCAACGAGGACTGGCGGCGACGGGGATCACTGATTGTCTGGGACACAGGAGTGTATTCAAATGCGAGCCATCCAGACA
CTCTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62